EMAIL THIS PAGE TO A FRIEND

SORBS1

sorbin and SH3 domain containing 1

Synonyms: CAP FLAF2 R85FL SH3D5 SH3P12 SORB1
Gene ID:
Mouse(20411) sorbin and SH3 domain containing 1
Rat(686098) sorbin and SH3 domain containing 1
chicken(423749) sorbin and SH3 domain containing 1
dog(100686806) sorbin and SH3 domain containing 1
domestic cat(101090050) sorbin and SH3 domain containing 1
Horse(100061292) sorbin and SH3 domain containing 1
cow(504625) sorbin and SH3 domain containing 1
sheep(101108178) sorbin and SH3 domain containing 1
naked mole-rat(101711592) sorbin and SH3 domain containing 1
domestic guinea pig(100735801) sorbin and SH3 domain containing 1
260 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009166 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009166 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009166 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006434 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006434 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006434 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034954 Rosetta Predictions human pricing
NM_001034955 Rosetta Predictions human pricing
NM_001034956 Rosetta Predictions human pricing
NM_001034957 Rosetta Predictions human pricing
NM_006434 Rosetta Predictions human pricing
NM_015385 Rosetta Predictions human pricing
NM_024991 Rosetta Predictions human pricing
XM_001066536 Rosetta Predictions rat pricing
NM_001034962 Rosetta Predictions mouse pricing
NM_001034963 Rosetta Predictions mouse pricing
NM_001034964 Rosetta Predictions mouse pricing
NM_009166 Rosetta Predictions mouse pricing
NM_178362 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027216 predicted 2644
2 SASI_Hs01_00027217 predicted 3966
3 SASI_Hs01_00027218 predicted 4072
4 SASI_Hs01_00027219 predicted 2658
5 SASI_Hs01_00027220 predicted 3952
6 SASI_Hs01_00027221 predicted 4100
7 SASI_Hs01_00027222 predicted 4397
8 SASI_Hs02_00308157 predicted 4188
9 SASI_Hs01_00027223 predicted 4329
10 SASI_Hs01_00027224 predicted 2665
11 SASI_Hs01_00027225 predicted 4289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220862 predicted 2717
2 SASI_Hs01_00220863 predicted 3543
3 SASI_Hs01_00220864 predicted 3651
4 SASI_Hs01_00220865 predicted 2716
5 SASI_Hs01_00220866 predicted 3529
6 SASI_Hs01_00220867 predicted 3682
7 SASI_Hs01_00220868 predicted 3981
8 SASI_Hs02_00308158 predicted 3768
9 SASI_Hs01_00220869 predicted 3905
10 SASI_Hs01_00220870 predicted 2729
11 SASI_Hs01_00220871 predicted 3863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083140 predicted 2201
2 SASI_Hs01_00083141 predicted 2805
3 SASI_Hs01_00083142 predicted 2914
4 SASI_Hs01_00083143 predicted 2209
5 SASI_Hs01_00083144 predicted 2796
6 SASI_Hs01_00083145 predicted 2940
7 SASI_Hs01_00083146 predicted 3236
8 SASI_Hs02_00308159 predicted 3035
9 SASI_Hs01_00083147 predicted 3168
10 SASI_Hs01_00083148 predicted 2217
11 SASI_Hs01_00083149 predicted 3128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184952 predicted 1764
2 SASI_Hs01_00184953 predicted 2308
3 SASI_Hs01_00184954 predicted 2419
4 SASI_Hs01_00184955 predicted 1769
5 SASI_Hs01_00184956 predicted 2297
6 SASI_Hs01_00184957 predicted 2447
7 SASI_Hs01_00184958 predicted 2749
8 SASI_Hs02_00308160 predicted 2531
9 SASI_Hs01_00184959 predicted 2674
10 SASI_Hs01_00184960 predicted 1785
11 SASI_Hs01_00184961 predicted 2629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043690 predicted 1595
2 SASI_Hs01_00043691 predicted 2138
3 SASI_Hs01_00043692 predicted 2254
4 SASI_Hs01_00043693 predicted 1602
5 SASI_Hs01_00043694 predicted 2134
6 SASI_Hs01_00043695 predicted 2281
7 SASI_Hs01_00043696 predicted 2572
8 SASI_Hs01_00043697 predicted 2371
9 SASI_Hs01_00043698 predicted 2505
10 SASI_Hs01_00043699 predicted 1614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039575 predicted 2179
2 SASI_Hs01_00039576 predicted 2716
3 SASI_Hs01_00039577 predicted 2825
4 SASI_Hs01_00039578 predicted 2177
5 SASI_Hs01_00039580 predicted 2860
6 SASI_Hs01_00039581 predicted 3157
7 SASI_Hs02_00347739 predicted 2940
8 SASI_Hs01_00039582 predicted 3081
9 SASI_Hs01_00039583 predicted 2191
10 SASI_Hs01_00039584 predicted 3030
11 SASI_Hs01_00039579 predicted 2713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129806 predicted 2073
2 SASI_Hs01_00129807 predicted 2610
3 SASI_Hs01_00129808 predicted 2723
4 SASI_Hs01_00129809 predicted 2079
5 SASI_Hs01_00129811 predicted 2747
6 SASI_Hs01_00129812 predicted 3052
7 SASI_Hs02_00357645 predicted 2838
8 SASI_Hs01_00129813 predicted 2983
9 SASI_Hs01_00129814 predicted 2091
10 SASI_Hs01_00129815 predicted 2929
11 SASI_Hs01_00129810 predicted 2605
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317853 predicted 1894
2 SASI_Rn02_00317854 predicted 3141
3 SASI_Rn02_00317855 predicted 1870
4 SASI_Rn02_00317856 predicted 2555
5 SASI_Rn02_00317857 predicted 2403
6 SASI_Rn02_00317858 predicted 1189
7 SASI_Rn02_00317859 predicted 1729
8 SASI_Rn02_00317860 predicted 3265
9 SASI_Rn02_00317861 predicted 966
10 SASI_Rn02_00317862 predicted 3933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034962 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100038 predicted 2145
2 SASI_Mm01_00100041 predicted 1779
3 SASI_Mm01_00100042 predicted 1783
4 SASI_Mm01_00100043 predicted 1842
5 SASI_Mm01_00100044 predicted 2301
6 SASI_Mm01_00100045 predicted 2323
7 SASI_Mm02_00289225 predicted 1896
8 SASI_Mm02_00289226 predicted 1781
9 SASI_Mm01_00100046 predicted 2106
10 SASI_Mm01_00100047 predicted 1801
11 SASI_Mm01_00100039 predicted 2068
12 SASI_Mm01_00100040 predicted 2022
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034963 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289227 predicted 2173
2 SASI_Mm02_00289228 predicted 1809
3 SASI_Mm02_00289229 predicted 1805
4 SASI_Mm02_00289230 predicted 1867
5 SASI_Mm01_00061214 predicted 2338
6 SASI_Mm02_00289231 predicted 2353
7 SASI_Mm02_00289232 predicted 1926
8 SASI_Mm02_00289233 predicted 1818
9 SASI_Mm02_00289234 predicted 2129
10 SASI_Mm02_00289235 predicted 1830
11 SASI_Mm01_00061209 predicted 1321
12 SASI_Mm01_00061210 predicted 936
13 SASI_Mm01_00061211 predicted 1119
14 SASI_Mm01_00061212 predicted 1715
15 SASI_Mm01_00061213 predicted 854
16 SASI_Mm01_00061215 predicted 1770
17 SASI_Mm01_00061216 predicted 449
18 SASI_Mm01_00061217 predicted 761
19 SASI_Mm01_00061218 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034964 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183490 predicted 2134
2 SASI_Mm01_00183493 predicted 1765
3 SASI_Mm01_00183494 predicted 1769
4 SASI_Mm01_00183495 predicted 1836
5 SASI_Mm01_00183496 predicted 2301
6 SASI_Mm01_00183497 predicted 2321
7 SASI_Mm02_00289236 predicted 1884
8 SASI_Mm02_00289237 predicted 1777
9 SASI_Mm01_00183498 predicted 2091
10 SASI_Mm01_00183499 predicted 1796
11 SASI_Mm01_00183491 predicted 2066
12 SASI_Mm01_00183492 predicted 2006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098958 predicted 2335
2 SASI_Mm01_00098961 predicted 1966
3 SASI_Mm01_00098962 predicted 1969
4 SASI_Mm01_00098963 predicted 2030
5 SASI_Mm01_00098964 predicted 2498
6 SASI_Mm01_00098965 predicted 2518
7 SASI_Mm02_00315511 predicted 2085
8 SASI_Mm02_00315512 predicted 1977
9 SASI_Mm01_00098966 predicted 2294
10 SASI_Mm01_00098967 predicted 1989
11 SASI_Mm01_00098959 predicted 2264
12 SASI_Mm01_00098960 predicted 2211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057047 predicted 3178
2 SASI_Mm01_00057050 predicted 2812
3 SASI_Mm01_00057051 predicted 2817
4 SASI_Mm01_00057052 predicted 2875
5 SASI_Mm01_00057053 predicted 3344
6 SASI_Mm01_00057054 predicted 3365
7 SASI_Mm02_00348743 predicted 2927
8 SASI_Mm02_00348744 predicted 2820
9 SASI_Mm01_00057055 predicted 3139
10 SASI_Mm01_00057056 predicted 2837
11 SASI_Mm01_00057048 predicted 3110
12 SASI_Mm01_00057049 predicted 3051
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009166
SORBS1 MISSION shRNA Bacterial Glycerol Stock
sorbin and SH3 domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009166.1-1268s1c1
Sequence:CCGGCCCTAGATAAGAAAGTGGATACTCGAGTATCCACTTTCTTATCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009166.1-671s1c1
Sequence:CCGGGTCCTTTACTAAACGAAGTTTCTCGAGAAACTTCGTTTAGTAAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009166.1-2500s1c1
Sequence:CCGGGCAGTTGGTAAAGAATTCAAACTCGAGTTTGAATTCTTTACCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009166.1-1825s1c1
Sequence:CCGGCGCACCTATATCGAGCTTCTTCTCGAGAAGAAGCTCGATATAGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009166.1-1909s1c1
Sequence:CCGGGCCATTGCAAAGTTTAACTTTCTCGAGAAAGTTAAACTTTGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009166
SORBS1 MISSION shRNA shRNA Plasmid DNA
sorbin and SH3 domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009166.1-1268s1c1
Sequence:CCGGCCCTAGATAAGAAAGTGGATACTCGAGTATCCACTTTCTTATCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009166.1-671s1c1
Sequence:CCGGGTCCTTTACTAAACGAAGTTTCTCGAGAAACTTCGTTTAGTAAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009166.1-2500s1c1
Sequence:CCGGGCAGTTGGTAAAGAATTCAAACTCGAGTTTGAATTCTTTACCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009166.1-1825s1c1
Sequence:CCGGCGCACCTATATCGAGCTTCTTCTCGAGAAGAAGCTCGATATAGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009166.1-1909s1c1
Sequence:CCGGGCCATTGCAAAGTTTAACTTTCTCGAGAAAGTTAAACTTTGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009166
SORBS1 MISSION shRNA Lentiviral Transduction Particles
sorbin and SH3 domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009166.1-1268s1c1
Sequence:CCGGCCCTAGATAAGAAAGTGGATACTCGAGTATCCACTTTCTTATCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009166.1-671s1c1
Sequence:CCGGGTCCTTTACTAAACGAAGTTTCTCGAGAAACTTCGTTTAGTAAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009166.1-2500s1c1
Sequence:CCGGGCAGTTGGTAAAGAATTCAAACTCGAGTTTGAATTCTTTACCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009166.1-1825s1c1
Sequence:CCGGCGCACCTATATCGAGCTTCTTCTCGAGAAGAAGCTCGATATAGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009166.1-1909s1c1
Sequence:CCGGGCCATTGCAAAGTTTAACTTTCTCGAGAAAGTTAAACTTTGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006434
SORBS1 MISSION shRNA Bacterial Glycerol Stock
sorbin and SH3 domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006434.1-1139s1c1
Sequence:CCGGGCTTGGAGAATGAGAGCCAAACTCGAGTTTGGCTCTCATTCTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006434.1-1387s1c1
Sequence:CCGGCCTCTGCAGAAGGGAGATATTCTCGAGAATATCTCCCTTCTGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006434.1-416s1c1
Sequence:CCGGCCACAACGATTGTCAATCCTACTCGAGTAGGATTGACAATCGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006434.1-663s1c1
Sequence:CCGGCCGGAACACTGAGAGATCAAACTCGAGTTTGATCTCTCAGTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006434.1-1559s1c1
Sequence:CCGGGAGAAGCTATTGCTAAGTTTACTCGAGTAAACTTAGCAATAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006434.2-364s21c1
Sequence:CCGGGATTCCAGTCCTCTACTAAATCTCGAGATTTAGTAGAGGACTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006434.2-793s21c1
Sequence:CCGGTACTCTCCCAGATACTCATTTCTCGAGAAATGAGTATCTGGGAGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006434
SORBS1 MISSION shRNA shRNA Plasmid DNA
sorbin and SH3 domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006434.1-1139s1c1
Sequence:CCGGGCTTGGAGAATGAGAGCCAAACTCGAGTTTGGCTCTCATTCTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006434.1-1387s1c1
Sequence:CCGGCCTCTGCAGAAGGGAGATATTCTCGAGAATATCTCCCTTCTGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006434.1-416s1c1
Sequence:CCGGCCACAACGATTGTCAATCCTACTCGAGTAGGATTGACAATCGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006434.1-663s1c1
Sequence:CCGGCCGGAACACTGAGAGATCAAACTCGAGTTTGATCTCTCAGTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006434.1-1559s1c1
Sequence:CCGGGAGAAGCTATTGCTAAGTTTACTCGAGTAAACTTAGCAATAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006434.2-364s21c1
Sequence:CCGGGATTCCAGTCCTCTACTAAATCTCGAGATTTAGTAGAGGACTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006434.2-793s21c1
Sequence:CCGGTACTCTCCCAGATACTCATTTCTCGAGAAATGAGTATCTGGGAGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006434
SORBS1 MISSION shRNA Lentiviral Transduction Particles
sorbin and SH3 domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006434.1-1139s1c1
Sequence:CCGGGCTTGGAGAATGAGAGCCAAACTCGAGTTTGGCTCTCATTCTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006434.1-1387s1c1
Sequence:CCGGCCTCTGCAGAAGGGAGATATTCTCGAGAATATCTCCCTTCTGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006434.1-416s1c1
Sequence:CCGGCCACAACGATTGTCAATCCTACTCGAGTAGGATTGACAATCGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006434.1-663s1c1
Sequence:CCGGCCGGAACACTGAGAGATCAAACTCGAGTTTGATCTCTCAGTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006434.1-1559s1c1
Sequence:CCGGGAGAAGCTATTGCTAAGTTTACTCGAGTAAACTTAGCAATAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006434.2-364s21c1
Sequence:CCGGGATTCCAGTCCTCTACTAAATCTCGAGATTTAGTAGAGGACTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006434.2-793s21c1
Sequence:CCGGTACTCTCCCAGATACTCATTTCTCGAGAAATGAGTATCTGGGAGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks