EMAIL THIS PAGE TO A FRIEND

SORBS3

sorbin and SH3 domain containing 3

Synonyms: SCAM-1 SCAM1 SH3D4
UniProtKB ID: O60504, Q5BJE4, Q6NX54, Q96FY4, Q9UQE4
Gene ID:
Human(10174) Summary: This gene encodes an SH3 domain-containing adaptor protein. The presence of SH3 domains play a role in this protein's ability to bind other cytoplasmic molecules and contribute to cystoskeletal organization, cell adhesion and migration, signaling, and gene expression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(20410) sorbin and SH3 domain containing 3
Rat(282843) sorbin and SH3 domain containing 3
Zebrafish(541478) sorbin and SH3 domain containing 3
Horse(100057399) sorbin and SH3 domain containing 3
domestic cat(101087734) sorbin and SH3 domain containing 3
dog(477383) sorbin and SH3 domain containing 3
cow(507914) sorbin and SH3 domain containing 3
sheep(101115002) sorbin and SH3 domain containing 3
naked mole-rat(101720992) sorbin and SH3 domain containing 3
domestic guinea pig(100730139) sorbin and SH3 domain containing 3
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005775 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005775 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005775 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011366 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011366 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011366 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018003 Rosetta Predictions human pricing
NM_005775 Rosetta Predictions human pricing
NM_001005762 Rosetta Predictions rat pricing
NM_011366 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200086 predicted 1220
2 SASI_Hs02_00306894 predicted 460
3 SASI_Hs01_00200088 predicted 1228
4 SASI_Hs01_00200089 predicted 600
5 SASI_Hs02_00306895 predicted 758
6 SASI_Hs02_00306896 predicted 1066
7 SASI_Hs01_00200092 predicted 1657
8 SASI_Hs02_00306897 predicted 1032
9 SASI_Hs02_00306898 predicted 532
10 SASI_Hs01_00200094 predicted 1438
11 SASI_Hs01_00200087 predicted 1491
12 SASI_Hs01_00200090 predicted 1205
13 SASI_Hs01_00200091 predicted 1624
14 SASI_Hs01_00200093 predicted 1495
15 SASI_Hs01_00200095 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117798 predicted 2300
2 SASI_Hs02_00340255 predicted 1549
3 SASI_Hs01_00117800 predicted 2319
4 SASI_Hs01_00117801 predicted 1681
5 SASI_Hs02_00340256 predicted 1842
6 SASI_Hs02_00340257 predicted 2150
7 SASI_Hs01_00117804 predicted 2740
8 SASI_Hs02_00340258 predicted 2106
9 SASI_Hs02_00340259 predicted 1611
10 SASI_Hs01_00117806 predicted 2519
11 SASI_Hs01_00117799 predicted 2611
12 SASI_Hs01_00117802 predicted 2319
13 SASI_Hs01_00117803 predicted 2742
14 SASI_Hs01_00117805 predicted 2607
15 SASI_Hs01_00117807 predicted 1776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005762 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067294 predicted 933
2 SASI_Rn01_00067295 predicted 2165
3 SASI_Rn01_00067296 predicted 420
4 SASI_Rn01_00067297 predicted 1623
5 SASI_Rn01_00067298 predicted 1669
6 SASI_Rn01_00067299 predicted 943
7 SASI_Rn01_00067301 predicted 1298
8 SASI_Rn01_00067302 predicted 1916
9 SASI_Rn02_00198434 predicted 1716
10 SASI_Rn02_00198435 predicted 735
11 SASI_Rn01_00067300 predicted 930
12 SASI_Rn01_00067303 predicted 2314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011366 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159080 predicted 2164
2 SASI_Mm01_00159081 predicted 910
3 SASI_Mm01_00159082 predicted 2018
4 SASI_Mm01_00159083 predicted 1528
5 SASI_Mm01_00159084 predicted 926
6 SASI_Mm01_00159085 predicted 1578
7 SASI_Mm01_00159086 predicted 1489
8 SASI_Mm01_00159087 predicted 350
9 SASI_Mm01_00159088 predicted 1168
10 SASI_Mm01_00159089 predicted 787
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005775
SORBS3 MISSION shRNA Bacterial Glycerol Stock
sorbin and SH3 domain containing 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005775.3-2592s1c1
Sequence:CCGGCCAAATACAGAGGTCTGCTTTCTCGAGAAAGCAGACCTCTGTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005775.3-906s1c1
Sequence:CCGGCGGCAACATCTTCCAGTGGAACTCGAGTTCCACTGGAAGATGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005775.3-2320s1c1
Sequence:CCGGCGGAACGTTCCCTGGAAATTACTCGAGTAATTTCCAGGGAACGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005775.3-463s1c1
Sequence:CCGGTGGCTCCAACACCCTTAATTTCTCGAGAAATTAAGGGTGTTGGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005775.3-1546s1c1
Sequence:CCGGGAAGGGTGACATTGTCTACATCTCGAGATGTAGACAATGTCACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005775.4-1791s21c1
Sequence:CCGGTCCGCAAGGTGAACGAGAACTCTCGAGAGTTCTCGTTCACCTTGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005775.4-1661s21c1
Sequence:CCGGGAGATCCCTAAGCCCATCAAGCTCGAGCTTGATGGGCTTAGGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005775
SORBS3 MISSION shRNA shRNA Plasmid DNA
sorbin and SH3 domain containing 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005775.3-2592s1c1
Sequence:CCGGCCAAATACAGAGGTCTGCTTTCTCGAGAAAGCAGACCTCTGTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005775.3-906s1c1
Sequence:CCGGCGGCAACATCTTCCAGTGGAACTCGAGTTCCACTGGAAGATGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005775.3-2320s1c1
Sequence:CCGGCGGAACGTTCCCTGGAAATTACTCGAGTAATTTCCAGGGAACGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005775.3-463s1c1
Sequence:CCGGTGGCTCCAACACCCTTAATTTCTCGAGAAATTAAGGGTGTTGGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005775.3-1546s1c1
Sequence:CCGGGAAGGGTGACATTGTCTACATCTCGAGATGTAGACAATGTCACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005775.4-1791s21c1
Sequence:CCGGTCCGCAAGGTGAACGAGAACTCTCGAGAGTTCTCGTTCACCTTGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005775.4-1661s21c1
Sequence:CCGGGAGATCCCTAAGCCCATCAAGCTCGAGCTTGATGGGCTTAGGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005775
SORBS3 MISSION shRNA Lentiviral Transduction Particles
sorbin and SH3 domain containing 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123144    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005775.3-2592s1c1
Sequence:CCGGCCAAATACAGAGGTCTGCTTTCTCGAGAAAGCAGACCTCTGTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005775.3-906s1c1
Sequence:CCGGCGGCAACATCTTCCAGTGGAACTCGAGTTCCACTGGAAGATGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005775.3-2320s1c1
Sequence:CCGGCGGAACGTTCCCTGGAAATTACTCGAGTAATTTCCAGGGAACGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005775.3-463s1c1
Sequence:CCGGTGGCTCCAACACCCTTAATTTCTCGAGAAATTAAGGGTGTTGGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005775.3-1546s1c1
Sequence:CCGGGAAGGGTGACATTGTCTACATCTCGAGATGTAGACAATGTCACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005775.4-1791s21c1
Sequence:CCGGTCCGCAAGGTGAACGAGAACTCTCGAGAGTTCTCGTTCACCTTGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005775.4-1661s21c1
Sequence:CCGGGAGATCCCTAAGCCCATCAAGCTCGAGCTTGATGGGCTTAGGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011366
SORBS3 MISSION shRNA Bacterial Glycerol Stock
sorbin and SH3 domain containing 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011366.1-925s1c1
Sequence:CCGGCGAACTAGAAACTGGGCATAACTCGAGTTATGCCCAGTTTCTAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011366.1-1490s1c1
Sequence:CCGGCCAGCTAATTATGTGGAGGTTCTCGAGAACCTCCACATAATTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011366.1-44s1c1
Sequence:CCGGGCTTCGTCTTTGAACAACAAACTCGAGTTTGTTGTTCAAAGACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011366.1-599s1c1
Sequence:CCGGCGAAGAATGTTCCAGCAAATTCTCGAGAATTTGCTGGAACATTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011366.1-2550s1c1
Sequence:CCGGCCTTTAATAAGGACCAGCCTTCTCGAGAAGGCTGGTCCTTATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011366.2-1249s21c1
Sequence:CCGGCTTTCTGGGACGTAGAGATTTCTCGAGAAATCTCTACGTCCCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011366.2-216s21c1
Sequence:CCGGGTCACCTCCGAACCCATATAGCTCGAGCTATATGGGTTCGGAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011366
SORBS3 MISSION shRNA shRNA Plasmid DNA
sorbin and SH3 domain containing 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011366.1-925s1c1
Sequence:CCGGCGAACTAGAAACTGGGCATAACTCGAGTTATGCCCAGTTTCTAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011366.1-1490s1c1
Sequence:CCGGCCAGCTAATTATGTGGAGGTTCTCGAGAACCTCCACATAATTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011366.1-44s1c1
Sequence:CCGGGCTTCGTCTTTGAACAACAAACTCGAGTTTGTTGTTCAAAGACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011366.1-599s1c1
Sequence:CCGGCGAAGAATGTTCCAGCAAATTCTCGAGAATTTGCTGGAACATTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011366.1-2550s1c1
Sequence:CCGGCCTTTAATAAGGACCAGCCTTCTCGAGAAGGCTGGTCCTTATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011366.2-1249s21c1
Sequence:CCGGCTTTCTGGGACGTAGAGATTTCTCGAGAAATCTCTACGTCCCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011366.2-216s21c1
Sequence:CCGGGTCACCTCCGAACCCATATAGCTCGAGCTATATGGGTTCGGAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011366
SORBS3 MISSION shRNA Lentiviral Transduction Particles
sorbin and SH3 domain containing 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011366.1-925s1c1
Sequence:CCGGCGAACTAGAAACTGGGCATAACTCGAGTTATGCCCAGTTTCTAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011366.1-1490s1c1
Sequence:CCGGCCAGCTAATTATGTGGAGGTTCTCGAGAACCTCCACATAATTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011366.1-44s1c1
Sequence:CCGGGCTTCGTCTTTGAACAACAAACTCGAGTTTGTTGTTCAAAGACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011366.1-599s1c1
Sequence:CCGGCGAAGAATGTTCCAGCAAATTCTCGAGAATTTGCTGGAACATTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011366.1-2550s1c1
Sequence:CCGGCCTTTAATAAGGACCAGCCTTCTCGAGAAGGCTGGTCCTTATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011366.2-1249s21c1
Sequence:CCGGCTTTCTGGGACGTAGAGATTTCTCGAGAAATCTCTACGTCCCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011366.2-216s21c1
Sequence:CCGGGTCACCTCCGAACCCATATAGCTCGAGCTATATGGGTTCGGAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks