EMAIL THIS PAGE TO A FRIEND

SORCS1

sortilin-related VPS10 domain containing receptor 1

Synonyms: hSorCS
Gene ID:
Human(114815) Summary: This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(58178) VPS10 domain receptor protein SORCS 1
Rat(309533) sortilin-related VPS10 domain containing receptor 1
Zebrafish(100332340) sortilin-related VPS10 domain containing receptor 1
chicken(423885) sortilin-related VPS10 domain containing receptor 1
Horse(100069383) sortilin-related VPS10 domain containing receptor 1
domestic cat(101097844) sortilin-related VPS10 domain containing receptor 1
dog(477816) sortilin-related VPS10 domain containing receptor 1
domestic guinea pig(100719252) sortilin-related VPS10 domain containing receptor 1
naked mole-rat(101720277) sortilin-related VPS10 domain containing receptor 1
cow(537536) sortilin-related VPS10 domain containing receptor 1
sheep(101116272) sortilin-related VPS10 domain containing receptor 1
338 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052918 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021377 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021377 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021377 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069601 MISSION® esiRNA esiRNA human SORCS1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013031 Rosetta Predictions human pricing
NM_052918 Rosetta Predictions human pricing
XM_001070775 Rosetta Predictions rat pricing
XM_220080 Rosetta Predictions rat pricing
NM_021377 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150856 predicted 2286
2 SASI_Hs02_00306327 predicted 1435
3 SASI_Hs01_00150858 predicted 1422
4 SASI_Hs01_00150859 predicted 1206
5 SASI_Hs01_00150860 predicted 2548
6 SASI_Hs01_00150861 predicted 949
7 SASI_Hs01_00150862 predicted 1250
8 SASI_Hs01_00150863 predicted 495
9 SASI_Hs02_00306328 predicted 2950
10 SASI_Hs01_00150864 predicted 1652
11 SASI_Hs01_00150855 predicted 1119
12 SASI_Hs01_00150857 predicted 1410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111329 predicted 2280
2 SASI_Hs02_00361676 predicted 1428
3 SASI_Hs01_00111331 predicted 1426
4 SASI_Hs01_00111332 predicted 1199
5 SASI_Hs01_00111333 predicted 2553
6 SASI_Hs01_00111334 predicted 955
7 SASI_Hs01_00111335 predicted 1249
8 SASI_Hs01_00111336 predicted 493
9 SASI_Hs02_00361677 predicted 2950
10 SASI_Hs01_00111337 predicted 1657
11 SASI_Hs01_00111328 predicted 1121
12 SASI_Hs01_00111330 predicted 1411
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332745 predicted 1436
2 SASI_Rn02_00332746 predicted 1098
3 SASI_Rn02_00332747 predicted 3124
4 SASI_Rn02_00332748 predicted 1192
5 SASI_Rn02_00332749 predicted 1211
6 SASI_Rn02_00332750 predicted 723
7 SASI_Rn02_00332751 predicted 2907
8 SASI_Rn02_00332752 predicted 1413
9 SASI_Rn02_00332753 predicted 1937
10 SASI_Rn02_00332754 predicted 1229
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379025 predicted 1931
2 SASI_Rn02_00379026 predicted 1600
3 SASI_Rn02_00379027 predicted 3624
4 SASI_Rn02_00379028 predicted 1687
5 SASI_Rn02_00379029 predicted 1706
6 SASI_Rn02_00379030 predicted 1222
7 SASI_Rn02_00379031 predicted 3407
8 SASI_Rn02_00379032 predicted 1908
9 SASI_Rn02_00379033 predicted 2436
10 SASI_Rn02_00379034 predicted 1717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021377 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048653 predicted 769
2 SASI_Mm01_00048655 predicted 1560
3 SASI_Mm01_00048656 predicted 1072
4 SASI_Mm01_00048657 predicted 3042
5 SASI_Mm02_00325968 predicted 2426
6 SASI_Mm02_00325969 predicted 3256
7 SASI_Mm01_00048658 predicted 1959
8 SASI_Mm01_00048659 predicted 2340
9 SASI_Mm01_00048660 predicted 2459
10 SASI_Mm01_00048661 predicted 1538
11 SASI_Mm01_00048654 predicted 1100
12 SASI_Mm01_00048662 predicted 3087
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052918
SORCS1 MISSION shRNA Bacterial Glycerol Stock
sortilin-related VPS10 domain containing receptor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052918.3-1416s21c1
Sequence:CCGGTATGAGGTAGCAGGGATAAAGCTCGAGCTTTATCCCTGCTACCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052918.3-628s21c1
Sequence:CCGGTTTGGAGGTCAACCGATTATGCTCGAGCATAATCGGTTGACCTCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052918.3-3355s21c1
Sequence:CCGGTGTTCGTCATCTACAAGTTTACTCGAGTAAACTTGTAGATGACGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052918.2-1169s1c1
Sequence:CCGGGCCACATTACTACGTGTCCTACTCGAGTAGGACACGTAGTAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052918.2-813s1c1
Sequence:CCGGCGGCTGAACTTCTACATTCAACTCGAGTTGAATGTAGAAGTTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052918.2-2120s1c1
Sequence:CCGGGCGGAAGTGTATGCAAGGAAACTCGAGTTTCCTTGCATACACTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052918.2-2914s1c1
Sequence:CCGGCCATCGCAGTATATGAGGAATCTCGAGATTCCTCATATACTGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052918.2-717s1c1
Sequence:CCGGCCTACCAACAAGCGTAAGATACTCGAGTATCTTACGCTTGTTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052918
SORCS1 MISSION shRNA shRNA Plasmid DNA
sortilin-related VPS10 domain containing receptor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052918.3-1416s21c1
Sequence:CCGGTATGAGGTAGCAGGGATAAAGCTCGAGCTTTATCCCTGCTACCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052918.3-628s21c1
Sequence:CCGGTTTGGAGGTCAACCGATTATGCTCGAGCATAATCGGTTGACCTCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052918.3-3355s21c1
Sequence:CCGGTGTTCGTCATCTACAAGTTTACTCGAGTAAACTTGTAGATGACGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052918.2-1169s1c1
Sequence:CCGGGCCACATTACTACGTGTCCTACTCGAGTAGGACACGTAGTAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052918.2-813s1c1
Sequence:CCGGCGGCTGAACTTCTACATTCAACTCGAGTTGAATGTAGAAGTTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052918.2-2120s1c1
Sequence:CCGGGCGGAAGTGTATGCAAGGAAACTCGAGTTTCCTTGCATACACTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052918.2-2914s1c1
Sequence:CCGGCCATCGCAGTATATGAGGAATCTCGAGATTCCTCATATACTGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052918.2-717s1c1
Sequence:CCGGCCTACCAACAAGCGTAAGATACTCGAGTATCTTACGCTTGTTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052918
SORCS1 MISSION shRNA Lentiviral Transduction Particles
sortilin-related VPS10 domain containing receptor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052918.3-1416s21c1
Sequence:CCGGTATGAGGTAGCAGGGATAAAGCTCGAGCTTTATCCCTGCTACCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052918.3-628s21c1
Sequence:CCGGTTTGGAGGTCAACCGATTATGCTCGAGCATAATCGGTTGACCTCCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052918.3-3355s21c1
Sequence:CCGGTGTTCGTCATCTACAAGTTTACTCGAGTAAACTTGTAGATGACGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052918.2-1169s1c1
Sequence:CCGGGCCACATTACTACGTGTCCTACTCGAGTAGGACACGTAGTAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052918.2-813s1c1
Sequence:CCGGCGGCTGAACTTCTACATTCAACTCGAGTTGAATGTAGAAGTTCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052918.2-2120s1c1
Sequence:CCGGGCGGAAGTGTATGCAAGGAAACTCGAGTTTCCTTGCATACACTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052918.2-2914s1c1
Sequence:CCGGCCATCGCAGTATATGAGGAATCTCGAGATTCCTCATATACTGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052918.2-717s1c1
Sequence:CCGGCCTACCAACAAGCGTAAGATACTCGAGTATCTTACGCTTGTTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021377
SORCS1 MISSION shRNA Bacterial Glycerol Stock
sortilin-related VPS10 domain containing receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021377.1-3571s1c1
Sequence:CCGGCGCTCTTGTCAAGTGCATCATCTCGAGATGATGCACTTGACAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021377.1-2920s1c1
Sequence:CCGGCCATTGCGGTATATGAGGAATCTCGAGATTCCTCATATACCGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021377.1-2921s1c1
Sequence:CCGGCATTGCGGTATATGAGGAATTCTCGAGAATTCCTCATATACCGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021377.1-3353s1c1
Sequence:CCGGGCTCGCTGTATTCGTCATCTACTCGAGTAGATGACGAATACAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021377.1-2190s1c1
Sequence:CCGGGCAGACTTTGACTGTGACTATCTCGAGATAGTCACAGTCAAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021377
SORCS1 MISSION shRNA shRNA Plasmid DNA
sortilin-related VPS10 domain containing receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021377.1-3571s1c1
Sequence:CCGGCGCTCTTGTCAAGTGCATCATCTCGAGATGATGCACTTGACAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021377.1-2920s1c1
Sequence:CCGGCCATTGCGGTATATGAGGAATCTCGAGATTCCTCATATACCGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021377.1-2921s1c1
Sequence:CCGGCATTGCGGTATATGAGGAATTCTCGAGAATTCCTCATATACCGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021377.1-3353s1c1
Sequence:CCGGGCTCGCTGTATTCGTCATCTACTCGAGTAGATGACGAATACAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021377.1-2190s1c1
Sequence:CCGGGCAGACTTTGACTGTGACTATCTCGAGATAGTCACAGTCAAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021377
SORCS1 MISSION shRNA Lentiviral Transduction Particles
sortilin-related VPS10 domain containing receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021377.1-3571s1c1
Sequence:CCGGCGCTCTTGTCAAGTGCATCATCTCGAGATGATGCACTTGACAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021377.1-2920s1c1
Sequence:CCGGCCATTGCGGTATATGAGGAATCTCGAGATTCCTCATATACCGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021377.1-2921s1c1
Sequence:CCGGCATTGCGGTATATGAGGAATTCTCGAGAATTCCTCATATACCGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021377.1-3353s1c1
Sequence:CCGGGCTCGCTGTATTCGTCATCTACTCGAGTAGATGACGAATACAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021377.1-2190s1c1
Sequence:CCGGGCAGACTTTGACTGTGACTATCTCGAGATAGTCACAGTCAAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks