EMAIL THIS PAGE TO A FRIEND

SORCS2

sortilin-related VPS10 domain containing receptor 2

UniProtKB ID: Q96PQ0, Q9P2L7
Gene ID:
Human(57537) Summary: This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
Mouse(81840) sortilin-related VPS10 domain containing receptor 2
Rat(305438) sortilin-related VPS10 domain containing receptor 2
cow(618257) sortilin-related VPS10 domain containing receptor 2
sheep(101118613) sortilin-related VPS10 domain containing receptor 2
naked mole-rat(101716827) sortilin-related VPS10 domain containing receptor 2
domestic guinea pig(100734859) sortilin-related VPS10 domain containing receptor 2
Zebrafish(100330371) sortilin-related VPS10 domain containing receptor 2
chicken(428797) sortilin-related VPS10 domain containing receptor 2
dog(488785) sortilin-related VPS10 domain containing receptor 2
Horse(100070344) sortilin-related VPS10 domain containing receptor 2
domestic cat(101089766) sortilin-related VPS10 domain containing receptor 2
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020777 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020777 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020777 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030889 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030889 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030889 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058891 MISSION® esiRNA esiRNA human SORCS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020777 Rosetta Predictions human pricing
NM_001107225 Rosetta Predictions rat pricing
NM_030889 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353919 predicted 652
2 SASI_Hs01_00010622 predicted 1135
3 SASI_Hs01_00010624 predicted 2177
4 SASI_Hs02_00353920 predicted 908
5 SASI_Hs01_00010626 predicted 2458
6 SASI_Hs02_00353921 predicted 845
7 SASI_Hs02_00353922 predicted 553
8 SASI_Hs02_00353923 predicted 683
9 SASI_Hs01_00010629 predicted 1107
10 SASI_Hs01_00010630 predicted 3034
11 SASI_Hs01_00010621 predicted 1298
12 SASI_Hs01_00010623 predicted 2655
13 SASI_Hs01_00010625 predicted 1643
14 SASI_Hs01_00010627 predicted 1293
15 SASI_Hs01_00010628 predicted 1305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107225 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226745 predicted 1667
2 SASI_Rn02_00226746 predicted 2527
3 SASI_Rn02_00226747 predicted 1866
4 SASI_Rn02_00226748 predicted 1620
5 SASI_Rn02_00226749 predicted 2253
6 SASI_Rn02_00226750 predicted 1480
7 SASI_Rn02_00226751 predicted 1682
8 SASI_Rn02_00226752 predicted 3223
9 SASI_Rn02_00226753 predicted 1184
10 SASI_Rn02_00226754 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167296 predicted 1354
2 SASI_Mm01_00167297 predicted 1044
3 SASI_Mm01_00167298 predicted 1185
4 SASI_Mm01_00167299 predicted 1626
5 SASI_Mm01_00167300 predicted 694
6 SASI_Mm01_00167301 predicted 572
7 SASI_Mm01_00167302 predicted 2557
8 SASI_Mm01_00167303 predicted 1443
9 SASI_Mm01_00167304 predicted 3126
10 SASI_Mm01_00167305 predicted 1200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020777
SORCS2 MISSION shRNA Bacterial Glycerol Stock
sortilin-related VPS10 domain containing receptor 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020777.1-949s1c1
Sequence:CCGGGCAGGACGATTACATCTTCTTCTCGAGAAGAAGATGTAATCGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020777.1-3037s1c1
Sequence:CCGGGAACGCACAGAAGATCAGCTTCTCGAGAAGCTGATCTTCTGTGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020777.1-1645s1c1
Sequence:CCGGCCCTTTGAAGATCCTCAAGTTCTCGAGAACTTGAGGATCTTCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020777.1-1042s1c1
Sequence:CCGGGCCGAAGTATGCATTGCCAAACTCGAGTTTGGCAATGCATACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020777.1-715s1c1
Sequence:CCGGGCTCTACGTGTCATCTGACTTCTCGAGAAGTCAGATGACACGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020777.2-1389s21c1
Sequence:CCGGGAAAGTGATGACGCTTATAACCTCGAGGTTATAAGCGTCATCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020777.2-1099s21c1
Sequence:CCGGTACGTCTCTTATCGTCGAAATCTCGAGATTTCGACGATAAGAGACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020777
SORCS2 MISSION shRNA shRNA Plasmid DNA
sortilin-related VPS10 domain containing receptor 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020777.1-949s1c1
Sequence:CCGGGCAGGACGATTACATCTTCTTCTCGAGAAGAAGATGTAATCGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020777.1-3037s1c1
Sequence:CCGGGAACGCACAGAAGATCAGCTTCTCGAGAAGCTGATCTTCTGTGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020777.1-1645s1c1
Sequence:CCGGCCCTTTGAAGATCCTCAAGTTCTCGAGAACTTGAGGATCTTCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020777.1-1042s1c1
Sequence:CCGGGCCGAAGTATGCATTGCCAAACTCGAGTTTGGCAATGCATACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020777.1-715s1c1
Sequence:CCGGGCTCTACGTGTCATCTGACTTCTCGAGAAGTCAGATGACACGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020777.2-1389s21c1
Sequence:CCGGGAAAGTGATGACGCTTATAACCTCGAGGTTATAAGCGTCATCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020777.2-1099s21c1
Sequence:CCGGTACGTCTCTTATCGTCGAAATCTCGAGATTTCGACGATAAGAGACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020777
SORCS2 MISSION shRNA Lentiviral Transduction Particles
sortilin-related VPS10 domain containing receptor 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020777.1-949s1c1
Sequence:CCGGGCAGGACGATTACATCTTCTTCTCGAGAAGAAGATGTAATCGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020777.1-3037s1c1
Sequence:CCGGGAACGCACAGAAGATCAGCTTCTCGAGAAGCTGATCTTCTGTGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020777.1-1645s1c1
Sequence:CCGGCCCTTTGAAGATCCTCAAGTTCTCGAGAACTTGAGGATCTTCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020777.1-1042s1c1
Sequence:CCGGGCCGAAGTATGCATTGCCAAACTCGAGTTTGGCAATGCATACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020777.1-715s1c1
Sequence:CCGGGCTCTACGTGTCATCTGACTTCTCGAGAAGTCAGATGACACGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020777.2-1389s21c1
Sequence:CCGGGAAAGTGATGACGCTTATAACCTCGAGGTTATAAGCGTCATCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020777.2-1099s21c1
Sequence:CCGGTACGTCTCTTATCGTCGAAATCTCGAGATTTCGACGATAAGAGACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030889
SORCS2 MISSION shRNA Bacterial Glycerol Stock
sortilin-related VPS10 domain containing receptor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030889.1-4634s1c1
Sequence:CCGGGCCTTGAAACTGAAGTCAGTACTCGAGTACTGACTTCAGTTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030889.1-1228s1c1
Sequence:CCGGCTACAGATCATCAGCACGGATCTCGAGATCCGTGCTGATGATCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030889.1-3194s1c1
Sequence:CCGGCGCTGAACTCTCATAGAATCACTCGAGTGATTCTATGAGAGTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030889.1-2448s1c1
Sequence:CCGGGCCTAGAGAAGATGTGCTGTTCTCGAGAACAGCACATCTTCTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030889.1-3066s1c1
Sequence:CCGGGCTGCTTGTGACTGTGGTAAACTCGAGTTTACCACAGTCACAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030889
SORCS2 MISSION shRNA shRNA Plasmid DNA
sortilin-related VPS10 domain containing receptor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030889.1-4634s1c1
Sequence:CCGGGCCTTGAAACTGAAGTCAGTACTCGAGTACTGACTTCAGTTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030889.1-1228s1c1
Sequence:CCGGCTACAGATCATCAGCACGGATCTCGAGATCCGTGCTGATGATCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030889.1-3194s1c1
Sequence:CCGGCGCTGAACTCTCATAGAATCACTCGAGTGATTCTATGAGAGTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030889.1-2448s1c1
Sequence:CCGGGCCTAGAGAAGATGTGCTGTTCTCGAGAACAGCACATCTTCTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030889.1-3066s1c1
Sequence:CCGGGCTGCTTGTGACTGTGGTAAACTCGAGTTTACCACAGTCACAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030889
SORCS2 MISSION shRNA Lentiviral Transduction Particles
sortilin-related VPS10 domain containing receptor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030889.1-4634s1c1
Sequence:CCGGGCCTTGAAACTGAAGTCAGTACTCGAGTACTGACTTCAGTTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030889.1-1228s1c1
Sequence:CCGGCTACAGATCATCAGCACGGATCTCGAGATCCGTGCTGATGATCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030889.1-3194s1c1
Sequence:CCGGCGCTGAACTCTCATAGAATCACTCGAGTGATTCTATGAGAGTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030889.1-2448s1c1
Sequence:CCGGGCCTAGAGAAGATGTGCTGTTCTCGAGAACAGCACATCTTCTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030889.1-3066s1c1
Sequence:CCGGGCTGCTTGTGACTGTGGTAAACTCGAGTTTACCACAGTCACAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks