EMAIL THIS PAGE TO A FRIEND

SORCS3

sortilin-related VPS10 domain containing receptor 3

Synonyms: SORCS
UniProtKB ID: Q9UPU3, Q5VXF9, Q9NQJ2
Gene ID:
Human(22986) Summary: This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. [provided by RefSeq, Jul 2008]
Mouse(66673) sortilin-related VPS10 domain containing receptor 3
Rat(294043) sortilin-related VPS10 domain containing receptor 3
Zebrafish(100534837) sortilin-related VPS10 domain containing receptor 3
chicken(423884) sortilin-related VPS10 domain containing receptor 3
domestic cat(101097597) sortilin-related VPS10 domain containing receptor 3
dog(486879) sortilin-related VPS10 domain containing receptor 3
domestic guinea pig(100719529) sortilin-related VPS10 domain containing receptor 3
naked mole-rat(101714148) sortilin-related VPS10 domain containing receptor 3
cow(531405) sortilin-related VPS10 domain containing receptor 3
sheep(101116006) sortilin-related VPS10 domain containing receptor 3
132 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014978 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014978 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014978 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025696 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025696 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025696 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001631 MISSION® esiRNA esiRNA targeting human SORCS3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014978 Rosetta Predictions human pricing
NM_001106367 Rosetta Predictions rat pricing
NM_025696 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210289 predicted 1457
2 SASI_Hs01_00210291 predicted 976
3 SASI_Hs01_00210292 predicted 3718
4 SASI_Hs01_00210293 predicted 3250
5 SASI_Hs01_00210294 predicted 1494
6 SASI_Hs01_00210295 predicted 3600
7 SASI_Hs01_00210296 predicted 3835
8 SASI_Hs01_00210298 predicted 1015
9 SASI_Hs02_00346695 predicted 831
10 SASI_Hs02_00346696 predicted 1972
11 SASI_Hs01_00210290 predicted 1759
12 SASI_Hs01_00210297 predicted 2344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106367 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218268 predicted 1959
2 SASI_Rn02_00218269 predicted 543
3 SASI_Rn02_00218270 predicted 794
4 SASI_Rn02_00218271 predicted 2074
5 SASI_Rn02_00218272 predicted 1602
6 SASI_Rn02_00218273 predicted 277
7 SASI_Rn02_00218274 predicted 503
8 SASI_Rn02_00218275 predicted 1155
9 SASI_Rn02_00218276 predicted 2069
10 SASI_Rn02_00218277 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035566 predicted 2698
2 SASI_Mm01_00035567 predicted 1438
3 SASI_Mm01_00035568 predicted 2665
4 SASI_Mm01_00035570 predicted 3298
5 SASI_Mm01_00035571 predicted 1889
6 SASI_Mm02_00328860 predicted 2562
7 SASI_Mm01_00035572 predicted 3062
8 SASI_Mm02_00328861 predicted 2255
9 SASI_Mm01_00035573 predicted 3164
10 SASI_Mm01_00035574 predicted 3211
11 SASI_Mm01_00035569 predicted 3174
12 SASI_Mm01_00035575 predicted 2908
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014978
SORCS3 MISSION shRNA Bacterial Glycerol Stock
sortilin-related VPS10 domain containing receptor 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014978.1-4148s21c1
Sequence:CCGGCTCTGCCATTGGTAGCTTAAACTCGAGTTTAAGCTACCAATGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014978.1-914s21c1
Sequence:CCGGACTATGGAGGTCGACAGATTACTCGAGTAATCTGTCGACCTCCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014978.1-1975s21c1
Sequence:CCGGAGCTCTCATATACTGATATTGCTCGAGCAATATCAGTATATGAGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014978.1-1548s21c1
Sequence:CCGGACAGACGAGAACCAAGTATTTCTCGAGAAATACTTGGTTCTCGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014978.1-1458s1c1
Sequence:CCGGGCCAGCTACTACGTGTCTTATCTCGAGATAAGACACGTAGTAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014978.1-2741s1c1
Sequence:CCGGGCACAATGCAACTTTCATCATCTCGAGATGATGAAAGTTGCATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014978.1-1713s1c1
Sequence:CCGGGCAGGTATCAAAGGGATATTTCTCGAGAAATATCCCTTTGATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014978.1-2984s1c1
Sequence:CCGGCCGAGTTCCATTTGTTGCCATCTCGAGATGGCAACAAATGGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014978.1-854s1c1
Sequence:CCGGCGTCATACTTATCCTGACGAACTCGAGTTCGTCAGGATAAGTATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014978
SORCS3 MISSION shRNA shRNA Plasmid DNA
sortilin-related VPS10 domain containing receptor 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014978.1-4148s21c1
Sequence:CCGGCTCTGCCATTGGTAGCTTAAACTCGAGTTTAAGCTACCAATGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014978.1-914s21c1
Sequence:CCGGACTATGGAGGTCGACAGATTACTCGAGTAATCTGTCGACCTCCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014978.1-1975s21c1
Sequence:CCGGAGCTCTCATATACTGATATTGCTCGAGCAATATCAGTATATGAGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014978.1-1548s21c1
Sequence:CCGGACAGACGAGAACCAAGTATTTCTCGAGAAATACTTGGTTCTCGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014978.1-1458s1c1
Sequence:CCGGGCCAGCTACTACGTGTCTTATCTCGAGATAAGACACGTAGTAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014978.1-2741s1c1
Sequence:CCGGGCACAATGCAACTTTCATCATCTCGAGATGATGAAAGTTGCATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014978.1-1713s1c1
Sequence:CCGGGCAGGTATCAAAGGGATATTTCTCGAGAAATATCCCTTTGATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014978.1-2984s1c1
Sequence:CCGGCCGAGTTCCATTTGTTGCCATCTCGAGATGGCAACAAATGGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014978.1-854s1c1
Sequence:CCGGCGTCATACTTATCCTGACGAACTCGAGTTCGTCAGGATAAGTATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014978
SORCS3 MISSION shRNA Lentiviral Transduction Particles
sortilin-related VPS10 domain containing receptor 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426648    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014978.1-4148s21c1
Sequence:CCGGCTCTGCCATTGGTAGCTTAAACTCGAGTTTAAGCTACCAATGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014978.1-914s21c1
Sequence:CCGGACTATGGAGGTCGACAGATTACTCGAGTAATCTGTCGACCTCCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014978.1-1975s21c1
Sequence:CCGGAGCTCTCATATACTGATATTGCTCGAGCAATATCAGTATATGAGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014978.1-1548s21c1
Sequence:CCGGACAGACGAGAACCAAGTATTTCTCGAGAAATACTTGGTTCTCGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014978.1-1458s1c1
Sequence:CCGGGCCAGCTACTACGTGTCTTATCTCGAGATAAGACACGTAGTAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014978.1-2741s1c1
Sequence:CCGGGCACAATGCAACTTTCATCATCTCGAGATGATGAAAGTTGCATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014978.1-1713s1c1
Sequence:CCGGGCAGGTATCAAAGGGATATTTCTCGAGAAATATCCCTTTGATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014978.1-2984s1c1
Sequence:CCGGCCGAGTTCCATTTGTTGCCATCTCGAGATGGCAACAAATGGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014978.1-854s1c1
Sequence:CCGGCGTCATACTTATCCTGACGAACTCGAGTTCGTCAGGATAAGTATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025696
SORCS3 MISSION shRNA Bacterial Glycerol Stock
sortilin-related VPS10 domain containing receptor 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025696.3-3394s1c1
Sequence:CCGGCACTATTTAATGCGCTTAATCCTCGAGGATTAAGCGCATTAAATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215775    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025696.3-4969s1c1
Sequence:CCGGCAAACAAAGATCTAGTCTTTACTCGAGTAAAGACTAGATCTTTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025696.3-4788s1c1
Sequence:CCGGCTAATTGGATTTCGTGGATATCTCGAGATATCCACGAAATCCAATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025696.1-3232s1c1
Sequence:CCGGGCAAGACATTGGCAATGTCATCTCGAGATGACATTGCCAATGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025696.1-1354s1c1
Sequence:CCGGCCAGGATGAATATATCTTCATCTCGAGATGAAGATATATTCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025696.1-2545s1c1
Sequence:CCGGCCGGAGGATTGTATCCAACAACTCGAGTTGTTGGATACAATCCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025696.1-3584s1c1
Sequence:CCGGGTGTTTCTGATCTACAAGTTTCTCGAGAAACTTGTAGATCAGAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025696.1-1912s1c1
Sequence:CCGGCGAACTCTCCTATACGGATATCTCGAGATATCCGTATAGGAGAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025696.1-3175s1c1
Sequence:CCGGGCTCTTATCGTTCTCTCCAAACTCGAGTTTGGAGAGAACGATAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025696.1-2680s1c1
Sequence:CCGGCCACAATGCAACCTTCATCATCTCGAGATGATGAAGGTTGCATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025696
SORCS3 MISSION shRNA shRNA Plasmid DNA
sortilin-related VPS10 domain containing receptor 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025696.3-3394s1c1
Sequence:CCGGCACTATTTAATGCGCTTAATCCTCGAGGATTAAGCGCATTAAATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215775    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025696.3-4969s1c1
Sequence:CCGGCAAACAAAGATCTAGTCTTTACTCGAGTAAAGACTAGATCTTTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025696.3-4788s1c1
Sequence:CCGGCTAATTGGATTTCGTGGATATCTCGAGATATCCACGAAATCCAATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025696.1-3232s1c1
Sequence:CCGGGCAAGACATTGGCAATGTCATCTCGAGATGACATTGCCAATGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025696.1-1354s1c1
Sequence:CCGGCCAGGATGAATATATCTTCATCTCGAGATGAAGATATATTCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025696.1-2545s1c1
Sequence:CCGGCCGGAGGATTGTATCCAACAACTCGAGTTGTTGGATACAATCCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025696.1-3584s1c1
Sequence:CCGGGTGTTTCTGATCTACAAGTTTCTCGAGAAACTTGTAGATCAGAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025696.1-1912s1c1
Sequence:CCGGCGAACTCTCCTATACGGATATCTCGAGATATCCGTATAGGAGAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025696.1-3175s1c1
Sequence:CCGGGCTCTTATCGTTCTCTCCAAACTCGAGTTTGGAGAGAACGATAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025696.1-2680s1c1
Sequence:CCGGCCACAATGCAACCTTCATCATCTCGAGATGATGAAGGTTGCATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025696
SORCS3 MISSION shRNA Lentiviral Transduction Particles
sortilin-related VPS10 domain containing receptor 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025696.3-3394s1c1
Sequence:CCGGCACTATTTAATGCGCTTAATCCTCGAGGATTAAGCGCATTAAATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215775    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025696.3-4969s1c1
Sequence:CCGGCAAACAAAGATCTAGTCTTTACTCGAGTAAAGACTAGATCTTTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025696.3-4788s1c1
Sequence:CCGGCTAATTGGATTTCGTGGATATCTCGAGATATCCACGAAATCCAATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025696.1-3232s1c1
Sequence:CCGGGCAAGACATTGGCAATGTCATCTCGAGATGACATTGCCAATGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025696.1-1354s1c1
Sequence:CCGGCCAGGATGAATATATCTTCATCTCGAGATGAAGATATATTCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025696.1-2545s1c1
Sequence:CCGGCCGGAGGATTGTATCCAACAACTCGAGTTGTTGGATACAATCCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025696.1-3584s1c1
Sequence:CCGGGTGTTTCTGATCTACAAGTTTCTCGAGAAACTTGTAGATCAGAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025696.1-1912s1c1
Sequence:CCGGCGAACTCTCCTATACGGATATCTCGAGATATCCGTATAGGAGAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025696.1-3175s1c1
Sequence:CCGGGCTCTTATCGTTCTCTCCAAACTCGAGTTTGGAGAGAACGATAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025696.1-2680s1c1
Sequence:CCGGCCACAATGCAACCTTCATCATCTCGAGATGATGAAGGTTGCATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks