EMAIL THIS PAGE TO A FRIEND

SORD

sorbitol dehydrogenase

Synonyms: SORD1
UniProtKB ID: Q00796, B2R655, J3JZZ5, Q16682, Q9UMD6
Gene ID:
Human(6652) Summary: Sorbitol dehydrogenase (SORD; EC 1.1.1.14) catalyzes the interconversion of polyols and their corresponding ketoses, and together with aldose reductase (ALDR1; MIM 103880), makes up the sorbitol pathway that is believed to play an important role in the development of diabetic complications (summarized by Carr and Markham, 1995 [PubMed 8535074]
Mouse(20322) sorbitol dehydrogenase
Rat(24788) sorbitol dehydrogenase
chicken(415332) sorbitol dehydrogenase
dog(487535) sorbitol dehydrogenase
domestic cat(101088085) sorbitol dehydrogenase
cow(508954) sorbitol dehydrogenase
sheep(101115280) sorbitol dehydrogenase
sheep(100294590) sorbitol dehydrogenase
naked mole-rat(101699735) sorbitol dehydrogenase
domestic guinea pig(100712656) sorbitol dehydrogenase
119 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146126 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146126 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146126 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003104 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003104 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003104 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003104 Rosetta Predictions human pricing
NM_017052 Rosetta Predictions rat pricing
NM_146126 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003104 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079190 predicted 1354
2 SASI_Hs02_00335067 predicted 1315
3 SASI_Hs01_00079192 predicted 568
4 SASI_Hs02_00335068 predicted 1203
5 SASI_Hs01_00079193 predicted 457
6 SASI_Hs01_00079194 predicted 788
7 SASI_Hs01_00079195 predicted 288
8 SASI_Hs01_00079196 predicted 371
9 SASI_Hs01_00079197 predicted 825
10 SASI_Hs02_00335069 predicted 1371
11 SASI_Hs01_00079191 predicted 721
12 SASI_Hs01_00079198 predicted 1445
13 SASI_Hs01_00079199 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017052 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034961 predicted 680
2 SASI_Rn01_00034962 predicted 1158
3 SASI_Rn01_00034963 predicted 779
4 SASI_Rn01_00034964 predicted 1186
5 SASI_Rn01_00034965 predicted 1241
6 SASI_Rn01_00034966 predicted 1158
7 SASI_Rn01_00034967 predicted 1247
8 SASI_Rn02_00261240 predicted 391
9 SASI_Rn02_00261241 predicted 398
10 SASI_Rn01_00034968 predicted 1224
11 SASI_Rn01_00034969 predicted 511
12 SASI_Rn01_00034970 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341789 predicted 991
2 SASI_Mm01_00179731 predicted 692
3 SASI_Mm01_00179733 predicted 704
4 SASI_Mm01_00179735 predicted 690
5 SASI_Mm01_00179734 predicted 1195
6 SASI_Mm01_00179736 predicted 289
7 SASI_Mm01_00179737 predicted 998
8 SASI_Mm01_00179738 predicted 432
9 SASI_Mm01_00179739 predicted 369
10 SASI_Mm01_00179740 predicted 660
11 SASI_Mm01_00179732 predicted 652
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146126
VALIDATED
SORD MISSION shRNA Bacterial Glycerol Stock
sorbitol dehydrogenase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146126.1-147s1c1
Sequence:CCGGGCCCAAATGATGTGTTACTAACTCGAGTTAGTAACACATCATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146126.1-442s1c1
Sequence:CCGGCTGCCGATTCTACAAGCACAACTCGAGTTGTGCTTGTAGAATCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146126.1-1012s1c1
Sequence:CCGGGCCCTTAGTTACCCACAGATTCTCGAGAATCTGTGGGTAACTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146126.1-296s1c1
Sequence:CCGGGAGTTGGTGAAACATCTGAAACTCGAGTTTCAGATGTTTCACCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146126.1-359s1c1
Sequence:CCGGGTAGATGAGTACTGCAAGATTCTCGAGAATCTTGCAGTACTCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146126.4-441s21c1
Sequence:CCGGCTGCCGATTCTACAAGCACAACTCGAGTTGTGCTTGTAGAATCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146126.4-1011s21c1
Sequence:CCGGGCCCTTAGTTACCCACAGATTCTCGAGAATCTGTGGGTAACTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146126.4-358s21c1
Sequence:CCGGGTAGATGAGTACTGCAAGATTCTCGAGAATCTTGCAGTACTCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146126.4-146s21c1
Sequence:CCGGGCCCAAATGATGTGTTACTAACTCGAGTTAGTAACACATCATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146126.4-295s21c1
Sequence:CCGGGAGTTGGTGAAACATCTGAAACTCGAGTTTCAGATGTTTCACCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146126
VALIDATED
SORD MISSION shRNA shRNA Plasmid DNA
sorbitol dehydrogenase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146126.1-147s1c1
Sequence:CCGGGCCCAAATGATGTGTTACTAACTCGAGTTAGTAACACATCATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146126.1-442s1c1
Sequence:CCGGCTGCCGATTCTACAAGCACAACTCGAGTTGTGCTTGTAGAATCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146126.1-1012s1c1
Sequence:CCGGGCCCTTAGTTACCCACAGATTCTCGAGAATCTGTGGGTAACTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146126.1-296s1c1
Sequence:CCGGGAGTTGGTGAAACATCTGAAACTCGAGTTTCAGATGTTTCACCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146126.1-359s1c1
Sequence:CCGGGTAGATGAGTACTGCAAGATTCTCGAGAATCTTGCAGTACTCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146126.4-441s21c1
Sequence:CCGGCTGCCGATTCTACAAGCACAACTCGAGTTGTGCTTGTAGAATCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146126.4-1011s21c1
Sequence:CCGGGCCCTTAGTTACCCACAGATTCTCGAGAATCTGTGGGTAACTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146126.4-358s21c1
Sequence:CCGGGTAGATGAGTACTGCAAGATTCTCGAGAATCTTGCAGTACTCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146126.4-146s21c1
Sequence:CCGGGCCCAAATGATGTGTTACTAACTCGAGTTAGTAACACATCATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146126.4-295s21c1
Sequence:CCGGGAGTTGGTGAAACATCTGAAACTCGAGTTTCAGATGTTTCACCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146126
VALIDATED
SORD MISSION shRNA Lentiviral Transduction Particles
sorbitol dehydrogenase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146126.1-147s1c1
Sequence:CCGGGCCCAAATGATGTGTTACTAACTCGAGTTAGTAACACATCATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146126.1-442s1c1
Sequence:CCGGCTGCCGATTCTACAAGCACAACTCGAGTTGTGCTTGTAGAATCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146126.1-1012s1c1
Sequence:CCGGGCCCTTAGTTACCCACAGATTCTCGAGAATCTGTGGGTAACTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146126.1-296s1c1
Sequence:CCGGGAGTTGGTGAAACATCTGAAACTCGAGTTTCAGATGTTTCACCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146126.1-359s1c1
Sequence:CCGGGTAGATGAGTACTGCAAGATTCTCGAGAATCTTGCAGTACTCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146126.4-441s21c1
Sequence:CCGGCTGCCGATTCTACAAGCACAACTCGAGTTGTGCTTGTAGAATCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146126.4-1011s21c1
Sequence:CCGGGCCCTTAGTTACCCACAGATTCTCGAGAATCTGTGGGTAACTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146126.4-358s21c1
Sequence:CCGGGTAGATGAGTACTGCAAGATTCTCGAGAATCTTGCAGTACTCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146126.4-146s21c1
Sequence:CCGGGCCCAAATGATGTGTTACTAACTCGAGTTAGTAACACATCATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146126.4-295s21c1
Sequence:CCGGGAGTTGGTGAAACATCTGAAACTCGAGTTTCAGATGTTTCACCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003104
VALIDATED
SORD MISSION shRNA Bacterial Glycerol Stock
sorbitol dehydrogenase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003104.3-1065s1c1
Sequence:CCGGCGTCCAAGTCTGTGAATGTAACTCGAGTTACATTCACAGACTTGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003104.3-197s1c1
Sequence:CCGGGAGAACTATCCTATCCCTGAACTCGAGTTCAGGGATAGGATAGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003104.3-456s1c1
Sequence:CCGGGCCGATACAATCTGTCACCTTCTCGAGAAGGTGACAGATTGTATCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003104.3-190s1c1
Sequence:CCGGGCGCCTGGAGAACTATCCTATCTCGAGATAGGATAGTTCTCCAGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003104.3-676s1c1
Sequence:CCGGGCCAATCGGGATGGTCACTTTCTCGAGAAAGTGACCATCCCGATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003104.4-1076s21c1
Sequence:CCGGCGTCCAAGTCTGTGAATGTAACTCGAGTTACATTCACAGACTTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003104.4-467s21c1
Sequence:CCGGGCCGATACAATCTGTCACCTTCTCGAGAAGGTGACAGATTGTATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003104.4-208s21c1
Sequence:CCGGGAGAACTATCCTATCCCTGAACTCGAGTTCAGGGATAGGATAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003104.4-687s21c1
Sequence:CCGGGCCAATCGGGATGGTCACTTTCTCGAGAAAGTGACCATCCCGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003104
VALIDATED
SORD MISSION shRNA shRNA Plasmid DNA
sorbitol dehydrogenase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003104.3-1065s1c1
Sequence:CCGGCGTCCAAGTCTGTGAATGTAACTCGAGTTACATTCACAGACTTGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003104.3-197s1c1
Sequence:CCGGGAGAACTATCCTATCCCTGAACTCGAGTTCAGGGATAGGATAGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003104.3-456s1c1
Sequence:CCGGGCCGATACAATCTGTCACCTTCTCGAGAAGGTGACAGATTGTATCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003104.3-190s1c1
Sequence:CCGGGCGCCTGGAGAACTATCCTATCTCGAGATAGGATAGTTCTCCAGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003104.3-676s1c1
Sequence:CCGGGCCAATCGGGATGGTCACTTTCTCGAGAAAGTGACCATCCCGATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003104.4-1076s21c1
Sequence:CCGGCGTCCAAGTCTGTGAATGTAACTCGAGTTACATTCACAGACTTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003104.4-467s21c1
Sequence:CCGGGCCGATACAATCTGTCACCTTCTCGAGAAGGTGACAGATTGTATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003104.4-208s21c1
Sequence:CCGGGAGAACTATCCTATCCCTGAACTCGAGTTCAGGGATAGGATAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003104.4-687s21c1
Sequence:CCGGGCCAATCGGGATGGTCACTTTCTCGAGAAAGTGACCATCCCGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003104
VALIDATED
SORD MISSION shRNA Lentiviral Transduction Particles
sorbitol dehydrogenase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003104.3-1065s1c1
Sequence:CCGGCGTCCAAGTCTGTGAATGTAACTCGAGTTACATTCACAGACTTGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003104.3-197s1c1
Sequence:CCGGGAGAACTATCCTATCCCTGAACTCGAGTTCAGGGATAGGATAGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003104.3-456s1c1
Sequence:CCGGGCCGATACAATCTGTCACCTTCTCGAGAAGGTGACAGATTGTATCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003104.3-190s1c1
Sequence:CCGGGCGCCTGGAGAACTATCCTATCTCGAGATAGGATAGTTCTCCAGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003104.3-676s1c1
Sequence:CCGGGCCAATCGGGATGGTCACTTTCTCGAGAAAGTGACCATCCCGATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003104.4-1076s21c1
Sequence:CCGGCGTCCAAGTCTGTGAATGTAACTCGAGTTACATTCACAGACTTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003104.4-467s21c1
Sequence:CCGGGCCGATACAATCTGTCACCTTCTCGAGAAGGTGACAGATTGTATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003104.4-208s21c1
Sequence:CCGGGAGAACTATCCTATCCCTGAACTCGAGTTCAGGGATAGGATAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003104.4-687s21c1
Sequence:CCGGGCCAATCGGGATGGTCACTTTCTCGAGAAAGTGACCATCCCGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks