EMAIL THIS PAGE TO A FRIEND

SORDL

Species: Human SORDL(116166)
Gene ID:
Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_007651
SORDL MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_007651.13-220s1c1
Sequence:CCGGGATCGTGTTGCCATCGAATCTCTCGAGAGATTCGATGGCAACACGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_007651.13-544s1c1
Sequence:CCGGGCTCAAGTAGTGGTGACTGATCTCGAGATCAGTCACCACTACTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_007651.13-48s1c1
Sequence:CCGGACCAGAGGTCTTGCTGAGGATCTCGAGATCCTCAGCAAGACCTCTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_007651.13-784s1c1
Sequence:CCGGAGAGGAACAATGGATCTGTGTCTCGAGACACAGATCCATTGTTCCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_007651.13-801s1c1
Sequence:CCGGGTGTGTGATTGATCTACCCATCTCGAGATGGGTAGATCAATCACACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_007651
SORDL MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_007651.13-220s1c1
Sequence:CCGGGATCGTGTTGCCATCGAATCTCTCGAGAGATTCGATGGCAACACGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_007651.13-544s1c1
Sequence:CCGGGCTCAAGTAGTGGTGACTGATCTCGAGATCAGTCACCACTACTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_007651.13-48s1c1
Sequence:CCGGACCAGAGGTCTTGCTGAGGATCTCGAGATCCTCAGCAAGACCTCTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_007651.13-784s1c1
Sequence:CCGGAGAGGAACAATGGATCTGTGTCTCGAGACACAGATCCATTGTTCCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_007651.13-801s1c1
Sequence:CCGGGTGTGTGATTGATCTACCCATCTCGAGATGGGTAGATCAATCACACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_007651
SORDL MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_007651.13-220s1c1
Sequence:CCGGGATCGTGTTGCCATCGAATCTCTCGAGAGATTCGATGGCAACACGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_007651.13-544s1c1
Sequence:CCGGGCTCAAGTAGTGGTGACTGATCTCGAGATCAGTCACCACTACTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_007651.13-48s1c1
Sequence:CCGGACCAGAGGTCTTGCTGAGGATCTCGAGATCCTCAGCAAGACCTCTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_007651.13-784s1c1
Sequence:CCGGAGAGGAACAATGGATCTGTGTCTCGAGACACAGATCCATTGTTCCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_007651.13-801s1c1
Sequence:CCGGGTGTGTGATTGATCTACCCATCTCGAGATGGGTAGATCAATCACACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks