EMAIL THIS PAGE TO A FRIEND

SORL1

sortilin-related receptor, L(DLR class) A repeats containing

Synonyms: C11orf32 LR11 LRP9 SORLA SorLA-1 gp250
UniProtKB ID: Q92673, B2RNX7, Q92856
Gene ID:
Human(6653) Summary: This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded protein is translated as a preproprotein and likely plays roles in endocytosis and sorting. There may be an association between expression of this locus and Alzheimer's Disease.[provided by RefSeq, Sep 2010]
Mouse(20660) sortilin-related receptor, LDLR class A repeats-containing
Rat(300652) sortilin-related receptor, LDLR class A repeats-containing
Zebrafish(497306) sortilin-related receptor, L(DLR class) A repeats containing
dog(479408) sortilin-related receptor, L(DLR class) A repeats containing
Horse(100071572) sortilin-related receptor, L(DLR class) A repeats containing
domestic cat(101086173) sortilin-related receptor, L(DLR class) A repeats containing
chicken(395998) sortilin-related receptor, L(DLR class) A repeats containing
domestic guinea pig(100714685) sortilin-related receptor, L(DLR class) A repeats containing
naked mole-rat(101713123) sortilin-related receptor, L(DLR class) A repeats containing
Domestic Rabbit(100009378) sortilin-related receptor, L(DLR class) A repeats containing
cow(533166) sortilin-related receptor, L(DLR class) A repeats containing
sheep(101117962) sortilin-related receptor, L(DLR class) A repeats containing
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011436 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011436 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011436 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003105 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003105 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003105 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003105 Rosetta Predictions human pricing
XM_001065506 Rosetta Predictions rat pricing
XM_217115 Rosetta Predictions rat pricing
NM_011436 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027276 predicted 6109
2 SASI_Hs02_00335070 predicted 601
3 SASI_Hs01_00027278 predicted 4121
4 SASI_Hs01_00027279 predicted 344
5 SASI_Hs01_00027281 predicted 5768
6 SASI_Hs01_00027282 predicted 5257
7 SASI_Hs02_00335071 predicted 3531
8 SASI_Hs02_00335072 predicted 2614
9 SASI_Hs02_00335073 predicted 1022
10 SASI_Hs01_00027284 predicted 706
11 SASI_Hs01_00027277 predicted 6292
12 SASI_Hs01_00027280 predicted 914
13 SASI_Hs01_00027283 predicted 1653
14 SASI_Hs01_00027285 predicted 5541
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314407 predicted 6101
2 SASI_Rn02_00314408 predicted 6509
3 SASI_Rn02_00314409 predicted 1176
4 SASI_Rn02_00314410 predicted 3197
5 SASI_Rn02_00314411 predicted 1052
6 SASI_Rn02_00314412 predicted 2356
7 SASI_Rn02_00314413 predicted 796
8 SASI_Rn02_00314414 predicted 3105
9 SASI_Rn02_00314415 predicted 1443
10 SASI_Rn02_00314416 predicted 5880
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377020 predicted 6427
2 SASI_Rn02_00377021 predicted 6087
3 SASI_Rn02_00377022 predicted 3404
4 SASI_Rn02_00377023 predicted 6484
5 SASI_Rn02_00377024 predicted 1173
6 SASI_Rn02_00377025 predicted 1049
7 SASI_Rn02_00377026 predicted 798
8 SASI_Rn02_00377027 predicted 1444
9 SASI_Rn02_00377028 predicted 2325
10 SASI_Rn02_00377029 predicted 5878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011436 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092194 predicted 4375
2 SASI_Mm02_00320661 predicted 1063
3 SASI_Mm02_00320662 predicted 1265
4 SASI_Mm01_00092197 predicted 5770
5 SASI_Mm01_00092202 predicted 1943
6 SASI_Mm02_00320663 predicted 3087
7 SASI_Mm02_00320664 predicted 5345
8 SASI_Mm02_00320665 predicted 2978
9 SASI_Mm02_00320666 predicted 3825
10 SASI_Mm01_00092199 predicted 684
11 SASI_Mm01_00092195 predicted 896
12 SASI_Mm01_00092196 predicted 4100
13 SASI_Mm01_00092198 predicted 1031
14 SASI_Mm01_00092200 predicted 2830
15 SASI_Mm01_00092201 predicted 4258
16 SASI_Mm01_00092203 predicted 2916
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011436
SORL1 MISSION shRNA Bacterial Glycerol Stock
sortilin-related receptor, L(DLR class) A repeats containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011436.1-5664s1c1
Sequence:CCGGCGTAACTACTTCGCTCCACAACTCGAGTTGTGGAGCGAAGTAGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011436.1-6036s1c1
Sequence:CCGGGAGCAAGGATTCCAGCATAAACTCGAGTTTATGCTGGAATCCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011436.1-2174s1c1
Sequence:CCGGCGAGAGGCTATCGGAAGATTTCTCGAGAAATCTTCCGATAGCCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011436.1-558s1c1
Sequence:CCGGCCTCTGGATCACGTTTGACTTCTCGAGAAGTCAAACGTGATCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011436.1-4106s1c1
Sequence:CCGGCCCGTTACTTTCAGTTCCACTCTCGAGAGTGGAACTGAAAGTAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011436
SORL1 MISSION shRNA shRNA Plasmid DNA
sortilin-related receptor, L(DLR class) A repeats containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011436.1-5664s1c1
Sequence:CCGGCGTAACTACTTCGCTCCACAACTCGAGTTGTGGAGCGAAGTAGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011436.1-6036s1c1
Sequence:CCGGGAGCAAGGATTCCAGCATAAACTCGAGTTTATGCTGGAATCCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011436.1-2174s1c1
Sequence:CCGGCGAGAGGCTATCGGAAGATTTCTCGAGAAATCTTCCGATAGCCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011436.1-558s1c1
Sequence:CCGGCCTCTGGATCACGTTTGACTTCTCGAGAAGTCAAACGTGATCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011436.1-4106s1c1
Sequence:CCGGCCCGTTACTTTCAGTTCCACTCTCGAGAGTGGAACTGAAAGTAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011436
SORL1 MISSION shRNA Lentiviral Transduction Particles
sortilin-related receptor, L(DLR class) A repeats containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011436.1-5664s1c1
Sequence:CCGGCGTAACTACTTCGCTCCACAACTCGAGTTGTGGAGCGAAGTAGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011436.1-6036s1c1
Sequence:CCGGGAGCAAGGATTCCAGCATAAACTCGAGTTTATGCTGGAATCCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011436.1-2174s1c1
Sequence:CCGGCGAGAGGCTATCGGAAGATTTCTCGAGAAATCTTCCGATAGCCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011436.1-558s1c1
Sequence:CCGGCCTCTGGATCACGTTTGACTTCTCGAGAAGTCAAACGTGATCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011436.1-4106s1c1
Sequence:CCGGCCCGTTACTTTCAGTTCCACTCTCGAGAGTGGAACTGAAAGTAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003105
VALIDATED
SORL1 MISSION shRNA Bacterial Glycerol Stock
sortilin-related receptor, L(DLR class) A repeats containing
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003105.3-1134s1c1
Sequence:CCGGGCCCAGTTTGTCACAAGACATCTCGAGATGTCTTGTGACAAACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003105.3-680s1c1
Sequence:CCGGCCTCTGGATCACGTTTGACTTCTCGAGAAGTCAAACGTGATCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003105.3-3010s1c1
Sequence:CCGGCCTATGCCATTGCTGTCTTTACTCGAGTAAAGACAGCAATGGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003105.3-6002s1c1
Sequence:CCGGCCAGGACTTGTTGTATGCAATCTCGAGATTGCATACAACAAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003105.3-5229s1c1
Sequence:CCGGGCTGCTAGTAACTTTACAGAACTCGAGTTCTGTAAAGTTACTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003105.4-4120s21c1
Sequence:CCGCTGGATGATTGCGGCGATTATTCTCGAGAATAATCGCCGCAATCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003105.4-3471s21c1
Sequence:CCGGTGTATCCCACTGTCCTATAAACTCGAGTTTATAGGACAGTGGGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003105.4-1176s21c1
Sequence:CCGGAGTAACAACCGCACCAATTTACTCGAGTAAATTGGTGCGGTTGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003105
VALIDATED
SORL1 MISSION shRNA shRNA Plasmid DNA
sortilin-related receptor, L(DLR class) A repeats containing
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003105.3-1134s1c1
Sequence:CCGGGCCCAGTTTGTCACAAGACATCTCGAGATGTCTTGTGACAAACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003105.3-680s1c1
Sequence:CCGGCCTCTGGATCACGTTTGACTTCTCGAGAAGTCAAACGTGATCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003105.3-3010s1c1
Sequence:CCGGCCTATGCCATTGCTGTCTTTACTCGAGTAAAGACAGCAATGGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003105.3-6002s1c1
Sequence:CCGGCCAGGACTTGTTGTATGCAATCTCGAGATTGCATACAACAAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003105.3-5229s1c1
Sequence:CCGGGCTGCTAGTAACTTTACAGAACTCGAGTTCTGTAAAGTTACTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003105.4-4120s21c1
Sequence:CCGCTGGATGATTGCGGCGATTATTCTCGAGAATAATCGCCGCAATCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003105.4-3471s21c1
Sequence:CCGGTGTATCCCACTGTCCTATAAACTCGAGTTTATAGGACAGTGGGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003105.4-1176s21c1
Sequence:CCGGAGTAACAACCGCACCAATTTACTCGAGTAAATTGGTGCGGTTGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003105
VALIDATED
SORL1 MISSION shRNA Lentiviral Transduction Particles
sortilin-related receptor, L(DLR class) A repeats containing
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003105.3-1134s1c1
Sequence:CCGGGCCCAGTTTGTCACAAGACATCTCGAGATGTCTTGTGACAAACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003105.3-680s1c1
Sequence:CCGGCCTCTGGATCACGTTTGACTTCTCGAGAAGTCAAACGTGATCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003105.3-3010s1c1
Sequence:CCGGCCTATGCCATTGCTGTCTTTACTCGAGTAAAGACAGCAATGGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003105.3-6002s1c1
Sequence:CCGGCCAGGACTTGTTGTATGCAATCTCGAGATTGCATACAACAAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003105.3-5229s1c1
Sequence:CCGGGCTGCTAGTAACTTTACAGAACTCGAGTTCTGTAAAGTTACTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003105.4-4120s21c1
Sequence:CCGCTGGATGATTGCGGCGATTATTCTCGAGAATAATCGCCGCAATCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003105.4-3471s21c1
Sequence:CCGGTGTATCCCACTGTCCTATAAACTCGAGTTTATAGGACAGTGGGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003105.4-1176s21c1
Sequence:CCGGAGTAACAACCGCACCAATTTACTCGAGTAAATTGGTGCGGTTGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks