EMAIL THIS PAGE TO A FRIEND

SORT1

sortilin 1

Synonyms: Gp95 LDLCQ6 NT3
UniProtKB ID: Q99523, B4DWI3, C0JYZ0, Q8IZ49
Gene ID:
Human(6272) Summary: This gene encodes a protein that is a multi-ligand type-1 receptor with similarity to the yeast carboxypeptidase Y sorting receptor Vps10 protein. The encoded protein, a trans-Golgi network (TGN) transmembrane protein, binds a number of unrelated ligands that participate in a wide range of cellular processes; however, it lacks the typical features of a signalling receptor. In the TGN, furin mediates the activation of the mature binding form. The encoded protein consists of a large luminal domain, a single transmembrane segment and short C-terminal cytoplasmic tail. The luminal domain contains a cysteine-rich region similar to two corresponding segments in the yeast Vps10p; the cytoplasmic tail is similar to the corresponding segment of the cation-independent mannose 6-phosphate receptor and the tail also interacts with the VHS domains of GGA (Golgi-associated, gamma-adaptin homologous, ARF-interacting) proteins. [provided by RefSeq, Jul 2008]
Mouse(20661) sortilin 1
Rat(83576) sortilin 1
cow(511591) sortilin 1
sheep(101104538) sortilin 1
chicken(100858592) sortilin 1
Horse(100061385) sortilin 1
dog(479915) sortilin 1
295 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002959 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002959 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002959 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019972 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019972 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019972 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002959 siRNAs that have been validated in the lab human pricing
XM_001070445 Rosetta Predictions rat pricing
XM_001070486 Rosetta Predictions rat pricing
XM_001076150 Rosetta Predictions rat pricing
XM_342317 Rosetta Predictions rat pricing
NM_019972 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002959 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209306 validated 831
2 SASI_Hs01_00209307 predicted 1673
3 SASI_Hs02_00334809 predicted 1411
4 SASI_Hs02_00334810 predicted 1111
5 SASI_Hs01_00209310 predicted 429
6 SASI_Hs02_00334811 predicted 2411
7 SASI_Hs01_00209311 predicted 1119
8 SASI_Hs01_00209312 predicted 587
9 SASI_Hs01_00209313 predicted 2522
10 SASI_Hs01_00209315 predicted 557
11 SASI_Hs01_00209308 predicted 1645
12 SASI_Hs01_00209309 predicted 722
13 SASI_Hs01_00209314 predicted 2571
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070445 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331698 predicted 2200
2 SASI_Rn02_00331699 predicted 1692
3 SASI_Rn02_00331700 predicted 1625
4 SASI_Rn02_00331701 predicted 1171
5 SASI_Rn02_00331702 predicted 1211
6 SASI_Rn02_00331703 predicted 674
7 SASI_Rn02_00331704 predicted 2243
8 SASI_Rn02_00331705 predicted 1178
9 SASI_Rn02_00331706 predicted 1204
10 SASI_Rn02_00331707 predicted 2146
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070486 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331828 predicted 2199
2 SASI_Rn02_00331829 predicted 1690
3 SASI_Rn02_00331830 predicted 1625
4 SASI_Rn02_00331831 predicted 1167
5 SASI_Rn02_00331832 predicted 1212
6 SASI_Rn02_00331833 predicted 676
7 SASI_Rn02_00331834 predicted 2243
8 SASI_Rn02_00331835 predicted 1181
9 SASI_Rn02_00331836 predicted 1198
10 SASI_Rn02_00331837 predicted 2147
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076150 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352231 predicted 2195
2 SASI_Rn02_00352232 predicted 1689
3 SASI_Rn02_00352233 predicted 1620
4 SASI_Rn02_00352234 predicted 1168
5 SASI_Rn02_00352235 predicted 1213
6 SASI_Rn02_00352236 predicted 677
7 SASI_Rn02_00352237 predicted 2246
8 SASI_Rn02_00352238 predicted 1176
9 SASI_Rn02_00352239 predicted 1202
10 SASI_Rn02_00352240 predicted 2143
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342317 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394107 predicted 2200
2 SASI_Rn02_00394108 predicted 1693
3 SASI_Rn02_00394109 predicted 1617
4 SASI_Rn02_00394110 predicted 1169
5 SASI_Rn02_00394111 predicted 1213
6 SASI_Rn02_00394112 predicted 679
7 SASI_Rn02_00394113 predicted 2240
8 SASI_Rn02_00394114 predicted 1178
9 SASI_Rn02_00394115 predicted 1204
10 SASI_Rn02_00394116 predicted 2140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019972 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087026 predicted 2444
2 SASI_Mm01_00087027 predicted 455
3 SASI_Mm01_00087028 predicted 1627
4 SASI_Mm01_00087029 predicted 1250
5 SASI_Mm01_00087030 predicted 2093
6 SASI_Mm01_00087032 predicted 497
7 SASI_Mm01_00087034 predicted 2126
8 SASI_Mm01_00087035 predicted 1596
9 SASI_Mm02_00325274 predicted 1548
10 SASI_Mm02_00325275 predicted 518
11 SASI_Mm01_00087031 predicted 466
12 SASI_Mm01_00087033 predicted 618
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002959
VALIDATED
SORT1 MISSION shRNA Bacterial Glycerol Stock
sortilin 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002959.4-1671s21c1
Sequence:CCGGGCCGTCCTATCAATGTGATTACTCGAGTAATCACATTGATAGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002959.4-537s21c1
Sequence:CCGGACACCTTTATTCGGACTGAATCTCGAGATTCAGTCCGAATAAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002959.4-480s21c1
Sequence:CCGGTATATCGAAGTGAGGATTATGCTCGAGCATAATCCTCACTTCGATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002959.3-548s1c1
Sequence:CCGGACACCTTTATTCGGACTGAATCTCGAGATTCAGTCCGAATAAAGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002959.3-2383s1c1
Sequence:CCGGGTGCTCATTGTGAAGAAATATCTCGAGATATTTCTTCACAATGAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002959.3-1682s1c1
Sequence:CCGGGCCGTCCTATCAATGTGATTACTCGAGTAATCACATTGATAGGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002959.3-1208s1c1
Sequence:CCGGGCATTGTCTATTCCAAGTCTTCTCGAGAAGACTTGGAATAGACAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002959.3-2620s1c1
Sequence:CCGGGCTCCAACTTCAGGAAATAAACTCGAGTTTATTTCCTGAAGTTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002959
VALIDATED
SORT1 MISSION shRNA shRNA Plasmid DNA
sortilin 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002959.4-1671s21c1
Sequence:CCGGGCCGTCCTATCAATGTGATTACTCGAGTAATCACATTGATAGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002959.4-537s21c1
Sequence:CCGGACACCTTTATTCGGACTGAATCTCGAGATTCAGTCCGAATAAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002959.4-480s21c1
Sequence:CCGGTATATCGAAGTGAGGATTATGCTCGAGCATAATCCTCACTTCGATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002959.3-548s1c1
Sequence:CCGGACACCTTTATTCGGACTGAATCTCGAGATTCAGTCCGAATAAAGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002959.3-2383s1c1
Sequence:CCGGGTGCTCATTGTGAAGAAATATCTCGAGATATTTCTTCACAATGAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002959.3-1682s1c1
Sequence:CCGGGCCGTCCTATCAATGTGATTACTCGAGTAATCACATTGATAGGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002959.3-1208s1c1
Sequence:CCGGGCATTGTCTATTCCAAGTCTTCTCGAGAAGACTTGGAATAGACAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002959.3-2620s1c1
Sequence:CCGGGCTCCAACTTCAGGAAATAAACTCGAGTTTATTTCCTGAAGTTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002959
VALIDATED
SORT1 MISSION shRNA Lentiviral Transduction Particles
sortilin 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002959.4-1671s21c1
Sequence:CCGGGCCGTCCTATCAATGTGATTACTCGAGTAATCACATTGATAGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002959.4-537s21c1
Sequence:CCGGACACCTTTATTCGGACTGAATCTCGAGATTCAGTCCGAATAAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002959.4-480s21c1
Sequence:CCGGTATATCGAAGTGAGGATTATGCTCGAGCATAATCCTCACTTCGATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002959.3-548s1c1
Sequence:CCGGACACCTTTATTCGGACTGAATCTCGAGATTCAGTCCGAATAAAGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002959.3-2383s1c1
Sequence:CCGGGTGCTCATTGTGAAGAAATATCTCGAGATATTTCTTCACAATGAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002959.3-1682s1c1
Sequence:CCGGGCCGTCCTATCAATGTGATTACTCGAGTAATCACATTGATAGGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002959.3-1208s1c1
Sequence:CCGGGCATTGTCTATTCCAAGTCTTCTCGAGAAGACTTGGAATAGACAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002959.3-2620s1c1
Sequence:CCGGGCTCCAACTTCAGGAAATAAACTCGAGTTTATTTCCTGAAGTTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019972
VALIDATED
SORT1 MISSION shRNA Bacterial Glycerol Stock
sortilin 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019972.2-399s21c1
Sequence:CCGGGCCTCTGGTAATTGTGAGCTTCTCGAGAAGCTCACAATTACCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019972.2-1376s21c1
Sequence:CCGGGCAGCCTTCATATCCATGCTTCTCGAGAAGCATGGATATGAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019972.2-2127s21c1
Sequence:CCGGGCACCTGACAACAAATGGGTACTCGAGTACCCATTTGTTGTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019972.2-1626s21c1
Sequence:CCGGCCGTCCTATCAATGTGATTAACTCGAGTTAATCACATTGATAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019972.2-1376s1c1
Sequence:CCGGGCAGCCTTCATATCCATGCTTCTCGAGAAGCATGGATATGAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019972.2-1626s1c1
Sequence:CCGGCCGTCCTATCAATGTGATTAACTCGAGTTAATCACATTGATAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019972.2-2127s1c1
Sequence:CCGGGCACCTGACAACAAATGGGTACTCGAGTACCCATTTGTTGTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019972.2-399s1c1
Sequence:CCGGGCCTCTGGTAATTGTGAGCTTCTCGAGAAGCTCACAATTACCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019972.2-2258s1c1
Sequence:CCGGCCAAGTCAAATTCTGTCCCTACTCGAGTAGGGACAGAATTTGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019972
VALIDATED
SORT1 MISSION shRNA shRNA Plasmid DNA
sortilin 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019972.2-399s21c1
Sequence:CCGGGCCTCTGGTAATTGTGAGCTTCTCGAGAAGCTCACAATTACCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019972.2-1376s21c1
Sequence:CCGGGCAGCCTTCATATCCATGCTTCTCGAGAAGCATGGATATGAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019972.2-2127s21c1
Sequence:CCGGGCACCTGACAACAAATGGGTACTCGAGTACCCATTTGTTGTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019972.2-1626s21c1
Sequence:CCGGCCGTCCTATCAATGTGATTAACTCGAGTTAATCACATTGATAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019972.2-1376s1c1
Sequence:CCGGGCAGCCTTCATATCCATGCTTCTCGAGAAGCATGGATATGAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019972.2-1626s1c1
Sequence:CCGGCCGTCCTATCAATGTGATTAACTCGAGTTAATCACATTGATAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019972.2-2127s1c1
Sequence:CCGGGCACCTGACAACAAATGGGTACTCGAGTACCCATTTGTTGTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019972.2-399s1c1
Sequence:CCGGGCCTCTGGTAATTGTGAGCTTCTCGAGAAGCTCACAATTACCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019972.2-2258s1c1
Sequence:CCGGCCAAGTCAAATTCTGTCCCTACTCGAGTAGGGACAGAATTTGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019972
VALIDATED
SORT1 MISSION shRNA Lentiviral Transduction Particles
sortilin 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019972.2-399s21c1
Sequence:CCGGGCCTCTGGTAATTGTGAGCTTCTCGAGAAGCTCACAATTACCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019972.2-1376s21c1
Sequence:CCGGGCAGCCTTCATATCCATGCTTCTCGAGAAGCATGGATATGAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019972.2-2127s21c1
Sequence:CCGGGCACCTGACAACAAATGGGTACTCGAGTACCCATTTGTTGTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019972.2-1626s21c1
Sequence:CCGGCCGTCCTATCAATGTGATTAACTCGAGTTAATCACATTGATAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019972.2-1376s1c1
Sequence:CCGGGCAGCCTTCATATCCATGCTTCTCGAGAAGCATGGATATGAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019972.2-1626s1c1
Sequence:CCGGCCGTCCTATCAATGTGATTAACTCGAGTTAATCACATTGATAGGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019972.2-2127s1c1
Sequence:CCGGGCACCTGACAACAAATGGGTACTCGAGTACCCATTTGTTGTCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019972.2-399s1c1
Sequence:CCGGGCCTCTGGTAATTGTGAGCTTCTCGAGAAGCTCACAATTACCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019972.2-2258s1c1
Sequence:CCGGCCAAGTCAAATTCTGTCCCTACTCGAGTAGGGACAGAATTTGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks