EMAIL THIS PAGE TO A FRIEND

SOS1

son of sevenless homolog 1 (Drosophila)

Synonyms: GF1 GGF1 GINGF HGF NS4
UniProtKB ID: Q07889, A8K2G3
Gene ID:
Human(6654) Summary: This gene encodes a protein that is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS proteins. The product of this gene may regulate RAS proteins by facilitating the exchange of GTP for GDP. Mutations in this gene are associated with gingival fibromatosis 1 and Noonan syndrome type 4. [provided by RefSeq, Jul 2008]
Mouse(20662) son of sevenless homolog 1 (Drosophila)
Rat(313845) Son of sevenless homolog 1 (Drosophila)
Thale Cress(814729) sodium/hydrogen exchanger 7
domestic cat(101098862) son of sevenless homolog 1 (Drosophila)
Horse(100053889) son of sevenless homolog 1 (Drosophila)
dog(483042) son of sevenless homolog 1 (Drosophila)
chicken(431192) son of sevenless homolog 1 (Drosophila)
Zebrafish(556286) son of sevenless homolog 1 (Drosophila)
domestic guinea pig(100721165) son of sevenless homolog 1 (Drosophila)
naked mole-rat(101707893) son of sevenless homolog 1 (Drosophila)
cow(537682) son of sevenless homolog 1 (Drosophila)
sheep(101118865) son of sevenless homolog 1 (Drosophila)
141 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005633 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009231 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009231 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009231 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005633 Rosetta Predictions human pricing
NM_001100716 Rosetta Predictions rat pricing
NM_009231 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088234 predicted 2267
2 SASI_Hs01_00088235 predicted 3546
3 SASI_Hs02_00339965 predicted 3336
4 SASI_Hs02_00339966 predicted 1959
5 SASI_Hs02_00339967 predicted 1012
6 SASI_Hs01_00088236 predicted 2374
7 SASI_Hs01_00088237 predicted 1237
8 SASI_Hs01_00088238 predicted 917
9 SASI_Hs01_00088239 predicted 3668
10 SASI_Hs01_00088240 predicted 2683
11 SASI_Hs01_00088241 predicted 1911
12 SASI_Hs01_00088242 predicted 3573
13 SASI_Hs01_00088243 predicted 1805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210368 predicted 3535
2 SASI_Rn02_00210369 predicted 1460
3 SASI_Rn02_00210370 predicted 750
4 SASI_Rn02_00210371 predicted 4052
5 SASI_Rn02_00210372 predicted 1927
6 SASI_Rn02_00210373 predicted 893
7 SASI_Rn02_00210374 predicted 3468
8 SASI_Rn02_00210375 predicted 1560
9 SASI_Rn02_00210376 predicted 2347
10 SASI_Rn02_00210377 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009231 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126679 predicted 1833
2 SASI_Mm01_00126681 predicted 1267
3 SASI_Mm01_00126682 predicted 3286
4 SASI_Mm01_00126683 predicted 3984
5 SASI_Mm01_00126685 predicted 2716
6 SASI_Mm01_00126686 predicted 2753
7 SASI_Mm01_00126687 predicted 1914
8 SASI_Mm01_00126688 predicted 4053
9 SASI_Mm02_00315686 predicted 3255
10 SASI_Mm02_00315687 predicted 2276
11 SASI_Mm01_00126680 predicted 210
12 SASI_Mm01_00126684 predicted 584
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005633
VALIDATED
SOS1 MISSION shRNA Bacterial Glycerol Stock
son of sevenless homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005633.2-3038s1c1
Sequence:CCGGCCCTAGAAATAGAACCACGAACTCGAGTTCGTGGTTCTATTTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005633.2-2341s1c1
Sequence:CCGGCCAATAGAAATTGCTCGACAACTCGAGTTGTCGAGCAATTTCTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005633.2-3293s1c1
Sequence:CCGGCCACAGATGTTTGCAGTGTATCTCGAGATACACTGCAAACATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005633.2-2275s1c1
Sequence:CCGGCCCACAGTTGAGTGGCATATACTCGAGTATATGCCACTCAACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005633.2-961s1c1
Sequence:CCGGGCACTTTATTTGCAGTCAATACTCGAGTATTGACTGCAAATAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005633.3-1002s21c1
Sequence:CCGGGCACTTTATTTGCAGTCAATACTCGAGTATTGACTGCAAATAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005633.3-2316s21c1
Sequence:CCGGCCCACAGTTGAGTGGCATATACTCGAGTATATGCCACTCAACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005633.3-3334s21c1
Sequence:CCGGCCACAGATGTTTGCAGTGTATCTCGAGATACACTGCAAACATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005633.3-3611s21c1
Sequence:CCGGAGCCTATTCACCACGATATTCCTCGAGGAATATCGTGGTGAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_005633.3-4112s21c1
Sequence:CCGGTGCCAGCACTGAGGAGTTAAACTCGAGTTTAACTCCTCAGTGCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005633
VALIDATED
SOS1 MISSION shRNA shRNA Plasmid DNA
son of sevenless homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005633.2-3038s1c1
Sequence:CCGGCCCTAGAAATAGAACCACGAACTCGAGTTCGTGGTTCTATTTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005633.2-2341s1c1
Sequence:CCGGCCAATAGAAATTGCTCGACAACTCGAGTTGTCGAGCAATTTCTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005633.2-3293s1c1
Sequence:CCGGCCACAGATGTTTGCAGTGTATCTCGAGATACACTGCAAACATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005633.2-2275s1c1
Sequence:CCGGCCCACAGTTGAGTGGCATATACTCGAGTATATGCCACTCAACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005633.2-961s1c1
Sequence:CCGGGCACTTTATTTGCAGTCAATACTCGAGTATTGACTGCAAATAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005633.3-1002s21c1
Sequence:CCGGGCACTTTATTTGCAGTCAATACTCGAGTATTGACTGCAAATAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005633.3-2316s21c1
Sequence:CCGGCCCACAGTTGAGTGGCATATACTCGAGTATATGCCACTCAACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005633.3-3334s21c1
Sequence:CCGGCCACAGATGTTTGCAGTGTATCTCGAGATACACTGCAAACATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005633.3-3611s21c1
Sequence:CCGGAGCCTATTCACCACGATATTCCTCGAGGAATATCGTGGTGAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_005633.3-4112s21c1
Sequence:CCGGTGCCAGCACTGAGGAGTTAAACTCGAGTTTAACTCCTCAGTGCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005633
VALIDATED
SOS1 MISSION shRNA Lentiviral Transduction Particles
son of sevenless homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005633.2-3038s1c1
Sequence:CCGGCCCTAGAAATAGAACCACGAACTCGAGTTCGTGGTTCTATTTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005633.2-2341s1c1
Sequence:CCGGCCAATAGAAATTGCTCGACAACTCGAGTTGTCGAGCAATTTCTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005633.2-3293s1c1
Sequence:CCGGCCACAGATGTTTGCAGTGTATCTCGAGATACACTGCAAACATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005633.2-2275s1c1
Sequence:CCGGCCCACAGTTGAGTGGCATATACTCGAGTATATGCCACTCAACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005633.2-961s1c1
Sequence:CCGGGCACTTTATTTGCAGTCAATACTCGAGTATTGACTGCAAATAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005633.3-1002s21c1
Sequence:CCGGGCACTTTATTTGCAGTCAATACTCGAGTATTGACTGCAAATAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005633.3-2316s21c1
Sequence:CCGGCCCACAGTTGAGTGGCATATACTCGAGTATATGCCACTCAACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005633.3-3334s21c1
Sequence:CCGGCCACAGATGTTTGCAGTGTATCTCGAGATACACTGCAAACATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005633.3-3611s21c1
Sequence:CCGGAGCCTATTCACCACGATATTCCTCGAGGAATATCGTGGTGAATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_005633.3-4112s21c1
Sequence:CCGGTGCCAGCACTGAGGAGTTAAACTCGAGTTTAACTCCTCAGTGCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009231
VALIDATED
SOS1 MISSION shRNA Bacterial Glycerol Stock
son of sevenless homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009231.1-2648s1c1
Sequence:CCGGCGGATAATTGAGATTCTACAACTCGAGTTGTAGAATCTCAATTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009231.1-3547s1c1
Sequence:CCGGCCCATCCAAGATTATGTCTAACTCGAGTTAGACATAATCTTGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009231.1-2330s1c1
Sequence:CCGGCCAGGTCATAACATTACATTTCTCGAGAAATGTAATGTTATGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009231.1-1049s1c1
Sequence:CCGGGCACTTTATTTGCAGTCCATACTCGAGTATGGACTGCAAATAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009231.1-457s1c1
Sequence:CCGGCCACCAGGTTTCTGTTTACATCTCGAGATGTAAACAGAAACCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009231.2-899s21c1
Sequence:CCGGCCACCAGGTTTCTGTTTACATCTCGAGATGTAAACAGAAACCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009231.2-3078s21c1
Sequence:CCGGGCTGTAGTAAGTCGGATAATTCTCGAGAATTATCCGACTTACTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009231.2-3379s21c1
Sequence:CCGGGACACGGGAAAGAGCTTATTACTCGAGTAATAAGCTCTTTCCCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009231.2-1404s21c1
Sequence:CCGGTTTGACCCGTATGAGTCATATCTCGAGATATGACTCATACGGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009231.2-4601s21c1
Sequence:CCGGTCTACTTCACGATGTAGTATACTCGAGTATACTACATCGTGAAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009231
VALIDATED
SOS1 MISSION shRNA shRNA Plasmid DNA
son of sevenless homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009231.1-2648s1c1
Sequence:CCGGCGGATAATTGAGATTCTACAACTCGAGTTGTAGAATCTCAATTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009231.1-3547s1c1
Sequence:CCGGCCCATCCAAGATTATGTCTAACTCGAGTTAGACATAATCTTGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009231.1-2330s1c1
Sequence:CCGGCCAGGTCATAACATTACATTTCTCGAGAAATGTAATGTTATGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009231.1-1049s1c1
Sequence:CCGGGCACTTTATTTGCAGTCCATACTCGAGTATGGACTGCAAATAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009231.1-457s1c1
Sequence:CCGGCCACCAGGTTTCTGTTTACATCTCGAGATGTAAACAGAAACCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009231.2-899s21c1
Sequence:CCGGCCACCAGGTTTCTGTTTACATCTCGAGATGTAAACAGAAACCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009231.2-3078s21c1
Sequence:CCGGGCTGTAGTAAGTCGGATAATTCTCGAGAATTATCCGACTTACTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009231.2-3379s21c1
Sequence:CCGGGACACGGGAAAGAGCTTATTACTCGAGTAATAAGCTCTTTCCCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009231.2-1404s21c1
Sequence:CCGGTTTGACCCGTATGAGTCATATCTCGAGATATGACTCATACGGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009231.2-4601s21c1
Sequence:CCGGTCTACTTCACGATGTAGTATACTCGAGTATACTACATCGTGAAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009231
VALIDATED
SOS1 MISSION shRNA Lentiviral Transduction Particles
son of sevenless homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009231.1-2648s1c1
Sequence:CCGGCGGATAATTGAGATTCTACAACTCGAGTTGTAGAATCTCAATTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009231.1-3547s1c1
Sequence:CCGGCCCATCCAAGATTATGTCTAACTCGAGTTAGACATAATCTTGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009231.1-2330s1c1
Sequence:CCGGCCAGGTCATAACATTACATTTCTCGAGAAATGTAATGTTATGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009231.1-1049s1c1
Sequence:CCGGGCACTTTATTTGCAGTCCATACTCGAGTATGGACTGCAAATAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009231.1-457s1c1
Sequence:CCGGCCACCAGGTTTCTGTTTACATCTCGAGATGTAAACAGAAACCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009231.2-899s21c1
Sequence:CCGGCCACCAGGTTTCTGTTTACATCTCGAGATGTAAACAGAAACCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009231.2-3078s21c1
Sequence:CCGGGCTGTAGTAAGTCGGATAATTCTCGAGAATTATCCGACTTACTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009231.2-3379s21c1
Sequence:CCGGGACACGGGAAAGAGCTTATTACTCGAGTAATAAGCTCTTTCCCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009231.2-1404s21c1
Sequence:CCGGTTTGACCCGTATGAGTCATATCTCGAGATATGACTCATACGGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009231.2-4601s21c1
Sequence:CCGGTCTACTTCACGATGTAGTATACTCGAGTATACTACATCGTGAAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks