EMAIL THIS PAGE TO A FRIEND

SOS2

son of sevenless homolog 2 (Drosophila)

UniProtKB ID: Q07890, D3DSB4, Q15503, Q17RN1
Gene ID:
Mouse(20663) son of sevenless homolog 2 (Drosophila)
Rat(85384) son of sevenless homolog 2 (Drosophila)
Thale Cress(833502) CBL-interacting serine/threonine-protein kinase 24
Zebrafish(561670) son of sevenless homolog 2 (Drosophila)
chicken(423572) son of sevenless homolog 2 (Drosophila)
Horse(100066282) son of sevenless homolog 2 (Drosophila)
domestic cat(101088847) son of sevenless homolog 2 (Drosophila)
dog(490682) son of sevenless homolog 2 (Drosophila)
cow(100138040) son of sevenless homolog 2 (Drosophila)
sheep(101102732) son of sevenless homolog 2 (Drosophila)
naked mole-rat(101701753) son of sevenless homolog 2 (Drosophila)
Domestic Rabbit(100346391) son of sevenless homolog 2 (Drosophila)
domestic guinea pig(100726398) son of sevenless homolog 2 (Drosophila)
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006939 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006939 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006939 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001135559 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001135559 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001135559 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_127051 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127051 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127051 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006939 Rosetta Predictions human pricing
XM_001080400 Rosetta Predictions rat pricing
XM_234263 Rosetta Predictions rat pricing
XM_127051 Rosetta Predictions mouse pricing
XM_916574 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342655 predicted 3263
2 SASI_Hs01_00082060 predicted 2016
3 SASI_Hs01_00082061 predicted 2365
4 SASI_Hs01_00082062 predicted 3354
5 SASI_Hs01_00082063 predicted 2708
6 SASI_Hs01_00082064 predicted 3040
7 SASI_Hs01_00082066 predicted 1248
8 SASI_Hs01_00082067 predicted 1122
9 SASI_Hs02_00342656 predicted 2135
10 SASI_Hs01_00082069 predicted 1242
11 SASI_Hs01_00082065 predicted 1699
12 SASI_Hs01_00082068 predicted 2043
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080400 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367875 predicted 536
2 SASI_Rn02_00367876 predicted 2922
3 SASI_Rn02_00367877 predicted 592
4 SASI_Rn02_00367878 predicted 448
5 SASI_Rn02_00367879 predicted 1410
6 SASI_Rn02_00367880 predicted 1317
7 SASI_Rn02_00367881 predicted 3186
8 SASI_Rn02_00367882 predicted 2275
9 SASI_Rn02_00367883 predicted 2050
10 SASI_Rn02_00367884 predicted 1873
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234263 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00163760 predicted 2341
2 SASI_Rn01_00163761 predicted 534
3 SASI_Rn01_00163762 predicted 2921
4 SASI_Rn01_00163763 predicted 593
5 SASI_Rn01_00163764 predicted 462
6 SASI_Rn01_00163765 predicted 1421
7 SASI_Rn01_00163766 predicted 1322
8 SASI_Rn01_00163767 predicted 3192
9 SASI_Rn01_00163768 predicted 2279
10 SASI_Rn01_00163769 predicted 1883
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209294 predicted 1945
2 SASI_Mm01_00209295 predicted 2124
3 SASI_Mm01_00209296 predicted 1085
4 SASI_Mm01_00209297 predicted 1284
5 SASI_Mm01_00209298 predicted 1583
6 SASI_Mm02_00424181 predicted 1225
7 SASI_Mm01_00209301 predicted 3136
8 SASI_Mm02_00424182 predicted 1235
9 SASI_Mm02_00424183 predicted 3887
10 SASI_Mm02_00424184 predicted 4245
11 SASI_Mm01_00209299 predicted 4016
12 SASI_Mm01_00209300 predicted 2191
13 SASI_Mm01_00209302 predicted 1872
14 SASI_Mm01_00209303 predicted 3866
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_916574 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440402 predicted 1033
2 SASI_Mm02_00440403 predicted 1216
3 SASI_Mm02_00440404 predicted 372
4 SASI_Mm02_00440405 predicted 671
5 SASI_Mm02_00440406 predicted 311
6 SASI_Mm02_00440407 predicted 2213
7 SASI_Mm02_00440408 predicted 884
8 SASI_Mm02_00440409 predicted 2945
9 SASI_Mm02_00440410 predicted 318
10 SASI_Mm02_00440411 predicted 2970
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006939
VALIDATED
SOS2 MISSION shRNA Bacterial Glycerol Stock
son of sevenless homolog 2 (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006939.2-3234s21c1
Sequence:CCGGGGCTCTACCTCAGGTACTTTACTCGAGTAAAGTACCTGAGGTAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006939.2-1245s21c1
Sequence:CCGGGGTAGCATGGACCGAATTTACCTCGAGGTAAATTCGGTCCATGCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006939.2-2143s21c1
Sequence:CCGGCAGTACAACTTAGGATCTTAACTCGAGTTAAGATCCTAAGTTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006939.1-477s1c1
Sequence:CCGGGCAGGACATTAAAGTGTCAATCTCGAGATTGACACTTTAATGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006939.1-1358s1c1
Sequence:CCGGCCAAACATGAACGGCATATTTCTCGAGAAATATGCCGTTCATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006939.1-334s1c1
Sequence:CCGGCCTTCGTTGAAGGAAGTATTACTCGAGTAATACTTCCTTCAACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006939.1-3828s1c1
Sequence:CCGGGCTCAGTTCTAGTCAGAATAACTCGAGTTATTCTGACTAGAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006939.1-2704s1c1
Sequence:CCGGGCTGTGGAATTAAGTCAAGATCTCGAGATCTTGACTTAATTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006939
VALIDATED
SOS2 MISSION shRNA shRNA Plasmid DNA
son of sevenless homolog 2 (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006939.2-3234s21c1
Sequence:CCGGGGCTCTACCTCAGGTACTTTACTCGAGTAAAGTACCTGAGGTAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006939.2-1245s21c1
Sequence:CCGGGGTAGCATGGACCGAATTTACCTCGAGGTAAATTCGGTCCATGCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006939.2-2143s21c1
Sequence:CCGGCAGTACAACTTAGGATCTTAACTCGAGTTAAGATCCTAAGTTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006939.1-477s1c1
Sequence:CCGGGCAGGACATTAAAGTGTCAATCTCGAGATTGACACTTTAATGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006939.1-1358s1c1
Sequence:CCGGCCAAACATGAACGGCATATTTCTCGAGAAATATGCCGTTCATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006939.1-334s1c1
Sequence:CCGGCCTTCGTTGAAGGAAGTATTACTCGAGTAATACTTCCTTCAACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006939.1-3828s1c1
Sequence:CCGGGCTCAGTTCTAGTCAGAATAACTCGAGTTATTCTGACTAGAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006939.1-2704s1c1
Sequence:CCGGGCTGTGGAATTAAGTCAAGATCTCGAGATCTTGACTTAATTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006939
VALIDATED
SOS2 MISSION shRNA Lentiviral Transduction Particles
son of sevenless homolog 2 (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006939.2-3234s21c1
Sequence:CCGGGGCTCTACCTCAGGTACTTTACTCGAGTAAAGTACCTGAGGTAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006939.2-1245s21c1
Sequence:CCGGGGTAGCATGGACCGAATTTACCTCGAGGTAAATTCGGTCCATGCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006939.2-2143s21c1
Sequence:CCGGCAGTACAACTTAGGATCTTAACTCGAGTTAAGATCCTAAGTTGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006939.1-477s1c1
Sequence:CCGGGCAGGACATTAAAGTGTCAATCTCGAGATTGACACTTTAATGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006939.1-1358s1c1
Sequence:CCGGCCAAACATGAACGGCATATTTCTCGAGAAATATGCCGTTCATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006939.1-334s1c1
Sequence:CCGGCCTTCGTTGAAGGAAGTATTACTCGAGTAATACTTCCTTCAACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006939.1-3828s1c1
Sequence:CCGGGCTCAGTTCTAGTCAGAATAACTCGAGTTATTCTGACTAGAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006939.1-2704s1c1
Sequence:CCGGGCTGTGGAATTAAGTCAAGATCTCGAGATCTTGACTTAATTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001135559
SOS2 MISSION shRNA Bacterial Glycerol Stock
son of sevenless homolog 2 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135559.1-4163s21c1
Sequence:CCGGGCTGCCACCAAAGACTTACAACTCGAGTTGTAAGTCTTTGGTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135559.1-2478s21c1
Sequence:CCGGGCAAATGGAATAAGCCATAATCTCGAGATTATGGCTTATTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001135559.1-4654s21c1
Sequence:CCGGGCCAGTATAAAGACTCTGTATCTCGAGATACAGAGTCTTTATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135559.1-631s21c1
Sequence:CCGGCCCTCTACATTGTGGCTGTATCTCGAGATACAGCCACAATGTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135559.1-2798s21c1
Sequence:CCGGGCTCAGCAGAATAGTAGAAATCTCGAGATTTCTACTATTCTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001135559
SOS2 MISSION shRNA shRNA Plasmid DNA
son of sevenless homolog 2 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135559.1-4163s21c1
Sequence:CCGGGCTGCCACCAAAGACTTACAACTCGAGTTGTAAGTCTTTGGTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135559.1-2478s21c1
Sequence:CCGGGCAAATGGAATAAGCCATAATCTCGAGATTATGGCTTATTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001135559.1-4654s21c1
Sequence:CCGGGCCAGTATAAAGACTCTGTATCTCGAGATACAGAGTCTTTATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135559.1-631s21c1
Sequence:CCGGCCCTCTACATTGTGGCTGTATCTCGAGATACAGCCACAATGTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135559.1-2798s21c1
Sequence:CCGGGCTCAGCAGAATAGTAGAAATCTCGAGATTTCTACTATTCTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001135559
SOS2 MISSION shRNA Lentiviral Transduction Particles
son of sevenless homolog 2 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135559.1-4163s21c1
Sequence:CCGGGCTGCCACCAAAGACTTACAACTCGAGTTGTAAGTCTTTGGTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135559.1-2478s21c1
Sequence:CCGGGCAAATGGAATAAGCCATAATCTCGAGATTATGGCTTATTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001135559.1-4654s21c1
Sequence:CCGGGCCAGTATAAAGACTCTGTATCTCGAGATACAGAGTCTTTATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135559.1-631s21c1
Sequence:CCGGCCCTCTACATTGTGGCTGTATCTCGAGATACAGCCACAATGTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135559.1-2798s21c1
Sequence:CCGGGCTCAGCAGAATAGTAGAAATCTCGAGATTTCTACTATTCTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127051
VALIDATED
SOS2 MISSION shRNA Bacterial Glycerol Stock
son of sevenless homolog 2 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_127051.5-4577s1c1
Sequence:CCGGGCCAGTATAAAGACTCTGTATCTCGAGATACAGAGTCTTTATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127051.5-2721s1c1
Sequence:CCGGGCTCAGCAGAATAGTAGAAATCTCGAGATTTCTACTATTCTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127051.5-2401s1c1
Sequence:CCGGGCAAATGGAATAAGCCATAATCTCGAGATTATGGCTTATTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127051.5-4086s1c1
Sequence:CCGGGCTGCCACCAAAGACTTACAACTCGAGTTGTAAGTCTTTGGTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127051.5-551s1c1
Sequence:CCGGCCCTCTACATTGTGGCTGTATCTCGAGATACAGCCACAATGTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127051
VALIDATED
SOS2 MISSION shRNA shRNA Plasmid DNA
son of sevenless homolog 2 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_127051.5-4577s1c1
Sequence:CCGGGCCAGTATAAAGACTCTGTATCTCGAGATACAGAGTCTTTATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127051.5-2721s1c1
Sequence:CCGGGCTCAGCAGAATAGTAGAAATCTCGAGATTTCTACTATTCTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127051.5-2401s1c1
Sequence:CCGGGCAAATGGAATAAGCCATAATCTCGAGATTATGGCTTATTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127051.5-4086s1c1
Sequence:CCGGGCTGCCACCAAAGACTTACAACTCGAGTTGTAAGTCTTTGGTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127051.5-551s1c1
Sequence:CCGGCCCTCTACATTGTGGCTGTATCTCGAGATACAGCCACAATGTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127051
VALIDATED
SOS2 MISSION shRNA Lentiviral Transduction Particles
son of sevenless homolog 2 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_127051.5-4577s1c1
Sequence:CCGGGCCAGTATAAAGACTCTGTATCTCGAGATACAGAGTCTTTATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127051.5-2721s1c1
Sequence:CCGGGCTCAGCAGAATAGTAGAAATCTCGAGATTTCTACTATTCTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127051.5-2401s1c1
Sequence:CCGGGCAAATGGAATAAGCCATAATCTCGAGATTATGGCTTATTCCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127051.5-4086s1c1
Sequence:CCGGGCTGCCACCAAAGACTTACAACTCGAGTTGTAAGTCTTTGGTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127051.5-551s1c1
Sequence:CCGGCCCTCTACATTGTGGCTGTATCTCGAGATACAGCCACAATGTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks