EMAIL THIS PAGE TO A FRIEND

SOST

sclerostin

Synonyms: CDD VBCH
UniProtKB ID: Q9BQB4, Q495N9
Gene ID:
Human(50964) Summary: Sclerostin is a secreted glycoprotein with a C-terminal cysteine knot-like (CTCK) domain and sequence similarity to the DAN (differential screening-selected gene aberrative in neuroblastoma) family of bone morphogenetic protein (BMP) antagonists. Loss-of-function mutations in this gene are associated with an autosomal-recessive disorder, sclerosteosis, which causes progressive bone overgrowth. A deletion downstream of this gene, which causes reduced sclerostin expression, is associated with a milder form of the disorder called van Buchem disease. [provided by RefSeq, Jul 2008]
Mouse(74499) sclerostin
Rat(80722) sclerostin
chicken(429784) sclerostin
dog(490948) sclerostin
cow(282880) sclerostin
sheep(101114123) sclerostin
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024449 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024449 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024449 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025237 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025237 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025237 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025237 Rosetta Predictions human pricing
NM_030584 Rosetta Predictions rat pricing
NM_024449 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025237 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038119 predicted 407
2 SASI_Hs01_00038121 predicted 252
3 SASI_Hs01_00038123 predicted 401
4 SASI_Hs01_00038124 predicted 430
5 SASI_Hs02_00358059 predicted 210
6 SASI_Hs02_00358060 predicted 431
7 SASI_Hs02_00358061 predicted 416
8 SASI_Hs02_00358062 predicted 416
9 SASI_Hs01_00038125 predicted 464
10 SASI_Hs01_00038127 predicted 1046
11 SASI_Hs01_00038120 predicted 299
12 SASI_Hs01_00038122 predicted 386
13 SASI_Hs01_00038126 predicted 766
14 SASI_Hs01_00038128 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030584 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035441 predicted 318
2 SASI_Rn01_00035442 predicted 304
3 SASI_Rn01_00035443 predicted 242
4 SASI_Rn01_00035444 predicted 259
5 SASI_Rn01_00035445 predicted 406
6 SASI_Rn01_00035446 predicted 426
7 SASI_Rn01_00035447 predicted 377
8 SASI_Rn01_00035448 predicted 446
9 SASI_Rn01_00035449 predicted 318
10 SASI_Rn01_00035450 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024449 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041334 predicted 246
2 SASI_Mm01_00041342 predicted 1175
3 SASI_Mm01_00041335 predicted 1142
4 SASI_Mm01_00041336 predicted 511
5 SASI_Mm01_00041337 predicted 1109
6 SASI_Mm02_00327792 predicted 232
7 SASI_Mm01_00041338 predicted 249
8 SASI_Mm01_00041339 predicted 1134
9 SASI_Mm01_00041341 predicted 1080
10 SASI_Mm01_00041343 predicted 282
11 SASI_Mm01_00041340 predicted 202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024449
SOST MISSION shRNA Bacterial Glycerol Stock
sclerostin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192754    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024449.3-1731s1c1
Sequence:CCGGCCTCTTACTTTCTGTGTAGATCTCGAGATCTACACAGAAAGTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190527    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024449.3-1245s1c1
Sequence:CCGGGCCTAGAAGAAGCTGTTTGTTCTCGAGAACAAACAGCTTCTTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190362    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024449.3-1594s1c1
Sequence:CCGGCCTCTGAGACAGCATATCTTACTCGAGTAAGATATGCTGTCTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024449.4-236s21c1
Sequence:CCGGACCATCCCTATGACGCCAAAGCTCGAGCTTTGGCGTCATAGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024449.4-659s21c1
Sequence:CCGGAGCTGGAGAACGCCTACTAGACTCGAGTCTAGTAGGCGTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024449.4-120s21c1
Sequence:CCGGGCAAGCCTTCAGGAATGATGCCTCGAGGCATCATTCCTGAAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024449.4-187s21c1
Sequence:CCGGGAGAACAACCAGACCATGAACCTCGAGGTTCATGGTCTGGTTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024449.4-1600s21c1
Sequence:CCGGGACAGCATATCTTACATTAAACTCGAGTTTAATGTAAGATATGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024449
SOST MISSION shRNA shRNA Plasmid DNA
sclerostin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192754    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024449.3-1731s1c1
Sequence:CCGGCCTCTTACTTTCTGTGTAGATCTCGAGATCTACACAGAAAGTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190527    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024449.3-1245s1c1
Sequence:CCGGGCCTAGAAGAAGCTGTTTGTTCTCGAGAACAAACAGCTTCTTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190362    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024449.3-1594s1c1
Sequence:CCGGCCTCTGAGACAGCATATCTTACTCGAGTAAGATATGCTGTCTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024449.4-236s21c1
Sequence:CCGGACCATCCCTATGACGCCAAAGCTCGAGCTTTGGCGTCATAGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024449.4-659s21c1
Sequence:CCGGAGCTGGAGAACGCCTACTAGACTCGAGTCTAGTAGGCGTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024449.4-120s21c1
Sequence:CCGGGCAAGCCTTCAGGAATGATGCCTCGAGGCATCATTCCTGAAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024449.4-187s21c1
Sequence:CCGGGAGAACAACCAGACCATGAACCTCGAGGTTCATGGTCTGGTTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024449.4-1600s21c1
Sequence:CCGGGACAGCATATCTTACATTAAACTCGAGTTTAATGTAAGATATGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024449
SOST MISSION shRNA Lentiviral Transduction Particles
sclerostin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192754    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024449.3-1731s1c1
Sequence:CCGGCCTCTTACTTTCTGTGTAGATCTCGAGATCTACACAGAAAGTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190527    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024449.3-1245s1c1
Sequence:CCGGGCCTAGAAGAAGCTGTTTGTTCTCGAGAACAAACAGCTTCTTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190362    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024449.3-1594s1c1
Sequence:CCGGCCTCTGAGACAGCATATCTTACTCGAGTAAGATATGCTGTCTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024449.4-236s21c1
Sequence:CCGGACCATCCCTATGACGCCAAAGCTCGAGCTTTGGCGTCATAGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024449.4-659s21c1
Sequence:CCGGAGCTGGAGAACGCCTACTAGACTCGAGTCTAGTAGGCGTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024449.4-120s21c1
Sequence:CCGGGCAAGCCTTCAGGAATGATGCCTCGAGGCATCATTCCTGAAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024449.4-187s21c1
Sequence:CCGGGAGAACAACCAGACCATGAACCTCGAGGTTCATGGTCTGGTTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024449.4-1600s21c1
Sequence:CCGGGACAGCATATCTTACATTAAACTCGAGTTTAATGTAAGATATGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025237
SOST MISSION shRNA Bacterial Glycerol Stock
sclerostin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025237.1-668s1c1
Sequence:CCGGCGAGCTGGAGAACGCCTACTACTCGAGTAGTAGGCGTTCTCCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025237.1-566s1c1
Sequence:CCGGCCACAACCAGTCGGAGCTCAACTCGAGTTGAGCTCCGACTGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025237.1-253s1c1
Sequence:CCGGCCTTTGAGACCAAAGACGTGTCTCGAGACACGTCTTTGGTCTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025237.1-92s1c1
Sequence:CCGGCACAGCCTTCCGTGTAGTGGACTCGAGTCCACTACACGGAAGGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025237.1-194s1c1
Sequence:CCGGGCTGGAGAACAACAAGACCATCTCGAGATGGTCTTGTTGTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025237.2-295s21c1
Sequence:CCGGTGCACTTCACCCGCTACGTGACTCGAGTCACGTAGCGGGTGAAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025237.2-957s21c1
Sequence:CCGGACCTTTGCTGGTCCCACTTCACTCGAGTGAAGTGGGACCAGCAAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025237
SOST MISSION shRNA shRNA Plasmid DNA
sclerostin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025237.1-668s1c1
Sequence:CCGGCGAGCTGGAGAACGCCTACTACTCGAGTAGTAGGCGTTCTCCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025237.1-566s1c1
Sequence:CCGGCCACAACCAGTCGGAGCTCAACTCGAGTTGAGCTCCGACTGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025237.1-253s1c1
Sequence:CCGGCCTTTGAGACCAAAGACGTGTCTCGAGACACGTCTTTGGTCTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025237.1-92s1c1
Sequence:CCGGCACAGCCTTCCGTGTAGTGGACTCGAGTCCACTACACGGAAGGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025237.1-194s1c1
Sequence:CCGGGCTGGAGAACAACAAGACCATCTCGAGATGGTCTTGTTGTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025237.2-295s21c1
Sequence:CCGGTGCACTTCACCCGCTACGTGACTCGAGTCACGTAGCGGGTGAAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025237.2-957s21c1
Sequence:CCGGACCTTTGCTGGTCCCACTTCACTCGAGTGAAGTGGGACCAGCAAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025237
SOST MISSION shRNA Lentiviral Transduction Particles
sclerostin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025237.1-668s1c1
Sequence:CCGGCGAGCTGGAGAACGCCTACTACTCGAGTAGTAGGCGTTCTCCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025237.1-566s1c1
Sequence:CCGGCCACAACCAGTCGGAGCTCAACTCGAGTTGAGCTCCGACTGGTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025237.1-253s1c1
Sequence:CCGGCCTTTGAGACCAAAGACGTGTCTCGAGACACGTCTTTGGTCTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025237.1-92s1c1
Sequence:CCGGCACAGCCTTCCGTGTAGTGGACTCGAGTCCACTACACGGAAGGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025237.1-194s1c1
Sequence:CCGGGCTGGAGAACAACAAGACCATCTCGAGATGGTCTTGTTGTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025237.2-295s21c1
Sequence:CCGGTGCACTTCACCCGCTACGTGACTCGAGTCACGTAGCGGGTGAAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025237.2-957s21c1
Sequence:CCGGACCTTTGCTGGTCCCACTTCACTCGAGTGAAGTGGGACCAGCAAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks