EMAIL THIS PAGE TO A FRIEND

SOSTDC1

sclerostin domain containing 1

Synonyms: ECTODIN USAG1
UniProtKB ID: Q6X4U4, Q96HJ7, Q9Y3U3
Gene ID:
Human(25928) Summary: This gene is a member of the sclerostin family and encodes an N-glycosylated, secreted protein with a C-terminal cystine knot-like domain. This protein functions as a bone morphogenetic protein (BMP) antagonist. Specifically, it directly associates with BMPs, prohibiting them from binding their receptors, thereby regulating BMP signaling during cellular proliferation, differentiation, and programmed cell death. [provided by RefSeq, Jul 2008]
Mouse(66042) sclerostin domain containing 1
Rat(266803) sclerostin domain containing 1
cow(523184) sclerostin domain containing 1
sheep(101104056) sclerostin domain containing 1
naked mole-rat(101712320) sclerostin domain containing 1
domestic guinea pig(100716997) sclerostin domain containing 1
chicken(378800) sclerostin domain containing 1
dog(482331) sclerostin domain containing 1
domestic cat(101083758) sclerostin domain containing 1
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302497 ANTI-SOSTDC1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB2107833 Anti-SOSTDC1 antibody produced in rabbit affinity isolated antibody human, horse, guinea pig, rabbit
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015464 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015464 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015464 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025312 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025312 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025312 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015464 Rosetta Predictions human pricing
NM_153737 Rosetta Predictions rat pricing
NM_025312 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149385 predicted 261
2 SASI_Hs01_00149386 predicted 403
3 SASI_Hs01_00149387 predicted 920
4 SASI_Hs01_00149388 predicted 844
5 SASI_Hs01_00149389 predicted 660
6 SASI_Hs01_00149390 predicted 314
7 SASI_Hs01_00149391 predicted 336
8 SASI_Hs01_00149392 predicted 830
9 SASI_Hs01_00149393 predicted 738
10 SASI_Hs02_00347889 predicted 654
11 SASI_Hs01_00149384 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153737 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081115 predicted 593
2 SASI_Rn01_00081116 predicted 300
3 SASI_Rn01_00081117 predicted 208
4 SASI_Rn01_00081119 predicted 420
5 SASI_Rn01_00081120 predicted 472
6 SASI_Rn01_00081121 predicted 552
7 SASI_Rn01_00081122 predicted 721
8 SASI_Rn01_00081123 predicted 580
9 SASI_Rn01_00081124 predicted 298
10 SASI_Rn02_00269036 predicted 493
11 SASI_Rn01_00081118 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025312 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171421 predicted 703
2 SASI_Mm01_00171422 predicted 681
3 SASI_Mm02_00327943 predicted 738
4 SASI_Mm01_00171423 predicted 594
5 SASI_Mm01_00171424 predicted 225
6 SASI_Mm01_00171426 predicted 548
7 SASI_Mm01_00171427 predicted 489
8 SASI_Mm01_00171428 predicted 572
9 SASI_Mm01_00171429 predicted 288
10 SASI_Mm01_00171430 predicted 259
11 SASI_Mm01_00171425 predicted 708
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015464
SOSTDC1 MISSION shRNA Bacterial Glycerol Stock
sclerostin domain containing 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015464.2-1001s21c1
Sequence:CCGGGTATATCCATGAATGCAATTTCTCGAGAAATTGCATTCATGGATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015464.2-409s21c1
Sequence:CCGGGGAACTGCGTTCCACCAAATACTCGAGTATTTGGTGGAACGCAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015464.2-1211s21c1
Sequence:CCGGTGAATCTTCACAGTAACATTTCTCGAGAAATGTTACTGTGAAGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138891    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015464.1-1344s1c1
Sequence:CCGGGTAGCTCTTTACGGTCGCATACTCGAGTATGCGACCGTAAAGAGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015464.1-260s1c1
Sequence:CCGGGATGCCACAGAAATCCTTTATCTCGAGATAAAGGATTTCTGTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015464.1-706s1c1
Sequence:CCGGCAGTCACAACTTTGAGAGCATCTCGAGATGCTCTCAAAGTTGTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135355    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015464.1-1250s1c1
Sequence:CCGGGTACTCTTCATGGGAACAGTTCTCGAGAACTGTTCCCATGAAGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015464.1-217s1c1
Sequence:CCGGCCTTGCATGCATCCTAATGAACTCGAGTTCATTAGGATGCATGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015464.1-355s1c1
Sequence:CCGGGCATTTCAGTAACACTGGACTCTCGAGAGTCCAGTGTTACTGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015464.1-324s1c1
Sequence:CCGGGCACGTTGAATCAAGCCAGAACTCGAGTTCTGGCTTGATTCAACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015464.1-537s1c1
Sequence:CCGGGAACAAAGTACTGGAGCAGGACTCGAGTCCTGCTCCAGTACTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015464
SOSTDC1 MISSION shRNA shRNA Plasmid DNA
sclerostin domain containing 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015464.2-1001s21c1
Sequence:CCGGGTATATCCATGAATGCAATTTCTCGAGAAATTGCATTCATGGATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015464.2-409s21c1
Sequence:CCGGGGAACTGCGTTCCACCAAATACTCGAGTATTTGGTGGAACGCAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015464.2-1211s21c1
Sequence:CCGGTGAATCTTCACAGTAACATTTCTCGAGAAATGTTACTGTGAAGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138891    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015464.1-1344s1c1
Sequence:CCGGGTAGCTCTTTACGGTCGCATACTCGAGTATGCGACCGTAAAGAGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015464.1-260s1c1
Sequence:CCGGGATGCCACAGAAATCCTTTATCTCGAGATAAAGGATTTCTGTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015464.1-706s1c1
Sequence:CCGGCAGTCACAACTTTGAGAGCATCTCGAGATGCTCTCAAAGTTGTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135355    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015464.1-1250s1c1
Sequence:CCGGGTACTCTTCATGGGAACAGTTCTCGAGAACTGTTCCCATGAAGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015464.1-217s1c1
Sequence:CCGGCCTTGCATGCATCCTAATGAACTCGAGTTCATTAGGATGCATGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015464.1-355s1c1
Sequence:CCGGGCATTTCAGTAACACTGGACTCTCGAGAGTCCAGTGTTACTGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015464.1-324s1c1
Sequence:CCGGGCACGTTGAATCAAGCCAGAACTCGAGTTCTGGCTTGATTCAACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015464.1-537s1c1
Sequence:CCGGGAACAAAGTACTGGAGCAGGACTCGAGTCCTGCTCCAGTACTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015464
SOSTDC1 MISSION shRNA Lentiviral Transduction Particles
sclerostin domain containing 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015464.2-1001s21c1
Sequence:CCGGGTATATCCATGAATGCAATTTCTCGAGAAATTGCATTCATGGATATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015464.2-409s21c1
Sequence:CCGGGGAACTGCGTTCCACCAAATACTCGAGTATTTGGTGGAACGCAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015464.2-1211s21c1
Sequence:CCGGTGAATCTTCACAGTAACATTTCTCGAGAAATGTTACTGTGAAGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138891    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015464.1-1344s1c1
Sequence:CCGGGTAGCTCTTTACGGTCGCATACTCGAGTATGCGACCGTAAAGAGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015464.1-260s1c1
Sequence:CCGGGATGCCACAGAAATCCTTTATCTCGAGATAAAGGATTTCTGTGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015464.1-706s1c1
Sequence:CCGGCAGTCACAACTTTGAGAGCATCTCGAGATGCTCTCAAAGTTGTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135355    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015464.1-1250s1c1
Sequence:CCGGGTACTCTTCATGGGAACAGTTCTCGAGAACTGTTCCCATGAAGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015464.1-217s1c1
Sequence:CCGGCCTTGCATGCATCCTAATGAACTCGAGTTCATTAGGATGCATGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015464.1-355s1c1
Sequence:CCGGGCATTTCAGTAACACTGGACTCTCGAGAGTCCAGTGTTACTGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015464.1-324s1c1
Sequence:CCGGGCACGTTGAATCAAGCCAGAACTCGAGTTCTGGCTTGATTCAACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015464.1-537s1c1
Sequence:CCGGGAACAAAGTACTGGAGCAGGACTCGAGTCCTGCTCCAGTACTTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025312
SOSTDC1 MISSION shRNA Bacterial Glycerol Stock
sclerostin domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025312.1-596s1c1
Sequence:CCGGGCCACAACTTTGAAAGCGTGTCTCGAGACACGCTTTCAAAGTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025312.1-262s1c1
Sequence:CCGGCTGGATCGAAACAGTCGAGTTCTCGAGAACTCGACTGTTTCGATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025312.1-419s1c1
Sequence:CCGGGCTATGGAACAAAGTACTGGACTCGAGTCCAGTACTTTGTTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025312.1-265s1c1
Sequence:CCGGGATCGAAACAGTCGAGTTCAACTCGAGTTGAACTCGACTGTTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025312.1-312s1c1
Sequence:CCGGCAAATACATTTCGGACGGCCACTCGAGTGGCCGTCCGAAATGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025312
SOSTDC1 MISSION shRNA shRNA Plasmid DNA
sclerostin domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025312.1-596s1c1
Sequence:CCGGGCCACAACTTTGAAAGCGTGTCTCGAGACACGCTTTCAAAGTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025312.1-262s1c1
Sequence:CCGGCTGGATCGAAACAGTCGAGTTCTCGAGAACTCGACTGTTTCGATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025312.1-419s1c1
Sequence:CCGGGCTATGGAACAAAGTACTGGACTCGAGTCCAGTACTTTGTTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025312.1-265s1c1
Sequence:CCGGGATCGAAACAGTCGAGTTCAACTCGAGTTGAACTCGACTGTTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025312.1-312s1c1
Sequence:CCGGCAAATACATTTCGGACGGCCACTCGAGTGGCCGTCCGAAATGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025312
SOSTDC1 MISSION shRNA Lentiviral Transduction Particles
sclerostin domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025312.1-596s1c1
Sequence:CCGGGCCACAACTTTGAAAGCGTGTCTCGAGACACGCTTTCAAAGTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025312.1-262s1c1
Sequence:CCGGCTGGATCGAAACAGTCGAGTTCTCGAGAACTCGACTGTTTCGATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025312.1-419s1c1
Sequence:CCGGGCTATGGAACAAAGTACTGGACTCGAGTCCAGTACTTTGTTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025312.1-265s1c1
Sequence:CCGGGATCGAAACAGTCGAGTTCAACTCGAGTTGAACTCGACTGTTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025312.1-312s1c1
Sequence:CCGGCAAATACATTTCGGACGGCCACTCGAGTGGCCGTCCGAAATGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks