EMAIL THIS PAGE TO A FRIEND

SOWAHA

sosondowah ankyrin repeat domain family member A

Synonyms: ANKRD43
UniProtKB ID: Q2M3V2, Q8NAE7
Gene ID:
Mouse(237761) sosondowah ankyrin repeat domain family member A
Rat(497903) sosondowah ankyrin repeat domain family member A
chicken(416334) sosondowah ankyrin repeat domain family member A
domestic cat(101085176) sosondowah ankyrin repeat domain family member A
cow(508297) sosondowah ankyrin repeat domain family member A
sheep(101118273) sosondowah ankyrin repeat domain family member A
domestic guinea pig(100734503) sosondowah ankyrin repeat domain family member A
naked mole-rat(101715026) sosondowah ankyrin repeat domain family member A
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183173 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183173 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183173 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175873 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175873 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175873 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175873 Rosetta Predictions human pricing
XM_001073996 Rosetta Predictions rat pricing
XM_573089 Rosetta Predictions rat pricing
NM_183173 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099017 predicted 2114
2 SASI_Hs01_00099018 predicted 2081
3 SASI_Hs01_00099019 predicted 1295
4 SASI_Hs01_00099020 predicted 1300
5 SASI_Hs01_00099021 predicted 2101
6 SASI_Hs01_00099022 predicted 1888
7 SASI_Hs01_00099023 predicted 1991
8 SASI_Hs01_00099024 predicted 1695
9 SASI_Hs01_00099025 predicted 771
10 SASI_Hs01_00099026 predicted 2155
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073996 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344673 predicted 1502
2 SASI_Rn02_00344674 predicted 1647
3 SASI_Rn02_00344675 predicted 1729
4 SASI_Rn02_00344676 predicted 951
5 SASI_Rn02_00344677 predicted 1129
6 SASI_Rn02_00344678 predicted 1790
7 SASI_Rn02_00344679 predicted 1640
8 SASI_Rn02_00344680 predicted 1551
9 SASI_Rn02_00344681 predicted 1430
10 SASI_Rn02_00344682 predicted 1674
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573089 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399767 predicted 1575
2 SASI_Rn02_00399768 predicted 1722
3 SASI_Rn02_00399769 predicted 1802
4 SASI_Rn02_00399770 predicted 1028
5 SASI_Rn02_00399771 predicted 1861
6 SASI_Rn02_00399772 predicted 1704
7 SASI_Rn02_00399773 predicted 1615
8 SASI_Rn02_00399774 predicted 1501
9 SASI_Rn02_00399775 predicted 1737
10 SASI_Rn02_00399776 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183173 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104033 predicted 2234
2 SASI_Mm02_00350269 predicted 462
3 SASI_Mm02_00350270 predicted 2059
4 SASI_Mm01_00104035 predicted 1299
5 SASI_Mm01_00104036 predicted 2087
6 SASI_Mm01_00104037 predicted 1251
7 SASI_Mm01_00104039 predicted 2139
8 SASI_Mm01_00104040 predicted 1931
9 SASI_Mm01_00104041 predicted 1585
10 SASI_Mm01_00104042 predicted 1475
11 SASI_Mm01_00104034 predicted 1953
12 SASI_Mm01_00104038 predicted 1981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183173
SOWAHA MISSION shRNA Bacterial Glycerol Stock
sosondowah ankyrin repeat domain family member A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183173.1-1775s1c1
Sequence:CCGGCCAGGACCTTTAGCTGGTTTACTCGAGTAAACCAGCTAAAGGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180286    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183173.1-1979s1c1
Sequence:CCGGCCTACAGAGATGGGATTCTTTCTCGAGAAAGAATCCCATCTCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183173.1-1657s1c1
Sequence:CCGGCTTGAAGAAGTCAAGTTCCTTCTCGAGAAGGAACTTGACTTCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183173.2-2604s21c1
Sequence:CCGGATACTGTGAATGTCGAATATTCTCGAGAATATTCGACATTCACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183173.2-1853s21c1
Sequence:CCGGTGCCGTCCTTCACCGAAATCTCTCGAGAGATTTCGGTGAAGGACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183173.2-462s21c1
Sequence:CCGGCCGCTTCAAGCAGTTCGTCAACTCGAGTTGACGAACTGCTTGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183173.2-1576s21c1
Sequence:CCGGTCCTACGCGCTGAGGCGTTTACTCGAGTAAACGCCTCAGCGCGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183173.2-1879s21c1
Sequence:CCGGCGATCCACTCCAGGACCTTTACTCGAGTAAAGGTCCTGGAGTGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183173
SOWAHA MISSION shRNA shRNA Plasmid DNA
sosondowah ankyrin repeat domain family member A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183173.1-1775s1c1
Sequence:CCGGCCAGGACCTTTAGCTGGTTTACTCGAGTAAACCAGCTAAAGGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180286    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183173.1-1979s1c1
Sequence:CCGGCCTACAGAGATGGGATTCTTTCTCGAGAAAGAATCCCATCTCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183173.1-1657s1c1
Sequence:CCGGCTTGAAGAAGTCAAGTTCCTTCTCGAGAAGGAACTTGACTTCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183173.2-2604s21c1
Sequence:CCGGATACTGTGAATGTCGAATATTCTCGAGAATATTCGACATTCACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183173.2-1853s21c1
Sequence:CCGGTGCCGTCCTTCACCGAAATCTCTCGAGAGATTTCGGTGAAGGACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183173.2-462s21c1
Sequence:CCGGCCGCTTCAAGCAGTTCGTCAACTCGAGTTGACGAACTGCTTGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183173.2-1576s21c1
Sequence:CCGGTCCTACGCGCTGAGGCGTTTACTCGAGTAAACGCCTCAGCGCGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183173.2-1879s21c1
Sequence:CCGGCGATCCACTCCAGGACCTTTACTCGAGTAAAGGTCCTGGAGTGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183173
SOWAHA MISSION shRNA Lentiviral Transduction Particles
sosondowah ankyrin repeat domain family member A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183173.1-1775s1c1
Sequence:CCGGCCAGGACCTTTAGCTGGTTTACTCGAGTAAACCAGCTAAAGGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180286    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183173.1-1979s1c1
Sequence:CCGGCCTACAGAGATGGGATTCTTTCTCGAGAAAGAATCCCATCTCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183173.1-1657s1c1
Sequence:CCGGCTTGAAGAAGTCAAGTTCCTTCTCGAGAAGGAACTTGACTTCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183173.2-2604s21c1
Sequence:CCGGATACTGTGAATGTCGAATATTCTCGAGAATATTCGACATTCACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183173.2-1853s21c1
Sequence:CCGGTGCCGTCCTTCACCGAAATCTCTCGAGAGATTTCGGTGAAGGACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183173.2-462s21c1
Sequence:CCGGCCGCTTCAAGCAGTTCGTCAACTCGAGTTGACGAACTGCTTGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183173.2-1576s21c1
Sequence:CCGGTCCTACGCGCTGAGGCGTTTACTCGAGTAAACGCCTCAGCGCGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183173.2-1879s21c1
Sequence:CCGGCGATCCACTCCAGGACCTTTACTCGAGTAAAGGTCCTGGAGTGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175873
VALIDATED
SOWAHA MISSION shRNA Bacterial Glycerol Stock
sosondowah ankyrin repeat domain family member A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175873.3-1597s1c1
Sequence:CCGGCCAGCCTTCTCAGAAATCTCTCTCGAGAGAGATTTCTGAGAAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_175873.3-1600s1c1
Sequence:CCGGGCCTTCTCAGAAATCTCTCGTCTCGAGACGAGAGATTTCTGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175873.3-1607s1c1
Sequence:CCGGCAGAAATCTCTCGTCGACCTACTCGAGTAGGTCGACGAGAGATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175873.3-1512s1c1
Sequence:CCGGCTTGAAGAAGTCGAGCTCCTTCTCGAGAAGGAGCTCGACTTCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_175873.3-1524s1c1
Sequence:CCGGGAGCTCCTTCAGCAAGTTCTTCTCGAGAAGAACTTGCTGAAGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175873.3-1609s1c1
Sequence:CCGGGAAATCTCTCGTCGACCTACTCTCGAGAGTAGGTCGACGAGAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_175873.3-2604s1c1
Sequence:CCGGGCCATGTTTCTGAATCTGGTTCTCGAGAACCAGATTCAGAAACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161375    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175873.3-2078s1c1
Sequence:CCGGGCTTTAAGATATGTGGTGGTTCTCGAGAACCACCACATATCTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175873.4-449s21c1
Sequence:CCGGCCGCTTCAAGCAGTTCGTCAACTCGAGTTGACGAACTGCTTGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175873.4-2393s21c1
Sequence:CCGGAGGTAATGCAACTTTCGTAATCTCGAGATTACGAAAGTTGCATTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175873.4-2286s21c1
Sequence:CCGGGCTAGAGCAAGGGTCTCTTTACTCGAGTAAAGAGACCCTTGCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175873
VALIDATED
SOWAHA MISSION shRNA shRNA Plasmid DNA
sosondowah ankyrin repeat domain family member A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175873.3-1597s1c1
Sequence:CCGGCCAGCCTTCTCAGAAATCTCTCTCGAGAGAGATTTCTGAGAAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_175873.3-1600s1c1
Sequence:CCGGGCCTTCTCAGAAATCTCTCGTCTCGAGACGAGAGATTTCTGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175873.3-1607s1c1
Sequence:CCGGCAGAAATCTCTCGTCGACCTACTCGAGTAGGTCGACGAGAGATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175873.3-1512s1c1
Sequence:CCGGCTTGAAGAAGTCGAGCTCCTTCTCGAGAAGGAGCTCGACTTCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_175873.3-1524s1c1
Sequence:CCGGGAGCTCCTTCAGCAAGTTCTTCTCGAGAAGAACTTGCTGAAGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175873.3-1609s1c1
Sequence:CCGGGAAATCTCTCGTCGACCTACTCTCGAGAGTAGGTCGACGAGAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_175873.3-2604s1c1
Sequence:CCGGGCCATGTTTCTGAATCTGGTTCTCGAGAACCAGATTCAGAAACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161375    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175873.3-2078s1c1
Sequence:CCGGGCTTTAAGATATGTGGTGGTTCTCGAGAACCACCACATATCTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175873.4-449s21c1
Sequence:CCGGCCGCTTCAAGCAGTTCGTCAACTCGAGTTGACGAACTGCTTGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175873.4-2393s21c1
Sequence:CCGGAGGTAATGCAACTTTCGTAATCTCGAGATTACGAAAGTTGCATTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175873.4-2286s21c1
Sequence:CCGGGCTAGAGCAAGGGTCTCTTTACTCGAGTAAAGAGACCCTTGCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175873
VALIDATED
SOWAHA MISSION shRNA Lentiviral Transduction Particles
sosondowah ankyrin repeat domain family member A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175873.3-1597s1c1
Sequence:CCGGCCAGCCTTCTCAGAAATCTCTCTCGAGAGAGATTTCTGAGAAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_175873.3-1600s1c1
Sequence:CCGGGCCTTCTCAGAAATCTCTCGTCTCGAGACGAGAGATTTCTGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175873.3-1607s1c1
Sequence:CCGGCAGAAATCTCTCGTCGACCTACTCGAGTAGGTCGACGAGAGATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175873.3-1512s1c1
Sequence:CCGGCTTGAAGAAGTCGAGCTCCTTCTCGAGAAGGAGCTCGACTTCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_175873.3-1524s1c1
Sequence:CCGGGAGCTCCTTCAGCAAGTTCTTCTCGAGAAGAACTTGCTGAAGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175873.3-1609s1c1
Sequence:CCGGGAAATCTCTCGTCGACCTACTCTCGAGAGTAGGTCGACGAGAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_175873.3-2604s1c1
Sequence:CCGGGCCATGTTTCTGAATCTGGTTCTCGAGAACCAGATTCAGAAACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161375    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175873.3-2078s1c1
Sequence:CCGGGCTTTAAGATATGTGGTGGTTCTCGAGAACCACCACATATCTTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175873.4-449s21c1
Sequence:CCGGCCGCTTCAAGCAGTTCGTCAACTCGAGTTGACGAACTGCTTGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175873.4-2393s21c1
Sequence:CCGGAGGTAATGCAACTTTCGTAATCTCGAGATTACGAAAGTTGCATTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175873.4-2286s21c1
Sequence:CCGGGCTAGAGCAAGGGTCTCTTTACTCGAGTAAAGAGACCCTTGCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks