EMAIL THIS PAGE TO A FRIEND

SOWAHB

sosondowah ankyrin repeat domain family member B

Synonyms: ANKRD56
UniProtKB ID: A6NEL2, B2RP29
Gene ID:
Mouse(78088) sosondowah ankyrin repeat domain family member B
Rat(289501) sosondowah ankyrin repeat domain family member B
naked mole-rat(101713095) sosondowah ankyrin repeat domain family member B
domestic guinea pig(100717135) sosondowah ankyrin repeat domain family member B
cow(512359) sosondowah ankyrin repeat domain family member B
sheep(101106527) sosondowah ankyrin repeat domain family member B
chicken(101748297) sosondowah ankyrin repeat domain family member B
chicken(101669500) sosondowah ankyrin repeat domain family member B
domestic cat(101090861) sosondowah ankyrin repeat domain family member B
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029870 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029870 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029870 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175270 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175270 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175270 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029870 Rosetta Predictions human pricing
XM_001070624 Rosetta Predictions rat pricing
XM_223228 Rosetta Predictions rat pricing
NM_175270 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125211 predicted 1619
2 SASI_Hs01_00125213 predicted 1168
3 SASI_Hs01_00125214 predicted 1514
4 SASI_Hs01_00125215 predicted 199
5 SASI_Hs01_00125216 predicted 2251
6 SASI_Hs01_00125217 predicted 2197
7 SASI_Hs01_00125218 predicted 2119
8 SASI_Hs01_00125219 predicted 1857
9 SASI_Hs01_00125220 predicted 1138
10 SASI_Hs02_00307547 predicted 721
11 SASI_Hs01_00125212 predicted 1976
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070624 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332265 predicted 2541
2 SASI_Rn02_00332266 predicted 649
3 SASI_Rn02_00332267 predicted 2552
4 SASI_Rn02_00332268 predicted 1769
5 SASI_Rn02_00332269 predicted 1981
6 SASI_Rn02_00332270 predicted 2627
7 SASI_Rn02_00332271 predicted 711
8 SASI_Rn02_00332272 predicted 1712
9 SASI_Rn02_00332273 predicted 2631
10 SASI_Rn02_00332274 predicted 1577
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223228 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381208 predicted 2541
2 SASI_Rn02_00381209 predicted 654
3 SASI_Rn02_00381210 predicted 2552
4 SASI_Rn02_00381211 predicted 1767
5 SASI_Rn02_00381212 predicted 1979
6 SASI_Rn02_00381213 predicted 2625
7 SASI_Rn02_00381214 predicted 704
8 SASI_Rn02_00381215 predicted 1711
9 SASI_Rn02_00381216 predicted 2623
10 SASI_Rn02_00381217 predicted 1581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175270 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152729 predicted 1750
2 SASI_Mm01_00152730 predicted 1712
3 SASI_Mm01_00152732 predicted 1617
4 SASI_Mm01_00152733 predicted 2037
5 SASI_Mm01_00152734 predicted 307
6 SASI_Mm01_00152735 predicted 2253
7 SASI_Mm01_00152736 predicted 1211
8 SASI_Mm01_00152737 predicted 2247
9 SASI_Mm01_00152738 predicted 2263
10 SASI_Mm02_00345985 predicted 1714
11 SASI_Mm01_00152731 predicted 299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029870
SOWAHB MISSION shRNA Bacterial Glycerol Stock
sosondowah ankyrin repeat domain family member B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029870.1-2075s21c1
Sequence:CCGGGGTTGGCTTCTCGGGTAAATGCTCGAGCATTTACCCGAGAAGCCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029870.1-1629s21c1
Sequence:CCGGTGATGCAGGTTTATCACTAAACTCGAGTTTAGTGATAAACCTGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029870.1-2120s1c1
Sequence:CCGGCATGGCAGTATCTAACCAGTACTCGAGTACTGGTTAGATACTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029870.1-1740s1c1
Sequence:CCGGCCACAGAACTTCTGAGCACAACTCGAGTTGTGCTCAGAAGTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029870.1-79s1c1
Sequence:CCGGCTGAGCCACTTCAAGAGCTTTCTCGAGAAAGCTCTTGAAGTGGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029870.1-2752s1c1
Sequence:CCGGCGAGGAATTGATGAAGCACAACTCGAGTTGTGCTTCATCAATTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029870.1-1513s1c1
Sequence:CCGGGCCAAATTGTCCTCCTCTGATCTCGAGATCAGAGGAGGACAATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029870.1-2753s1c1
Sequence:CCGGGAGGAATTGATGAAGCACAATCTCGAGATTGTGCTTCATCAATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029870
SOWAHB MISSION shRNA shRNA Plasmid DNA
sosondowah ankyrin repeat domain family member B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029870.1-2075s21c1
Sequence:CCGGGGTTGGCTTCTCGGGTAAATGCTCGAGCATTTACCCGAGAAGCCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029870.1-1629s21c1
Sequence:CCGGTGATGCAGGTTTATCACTAAACTCGAGTTTAGTGATAAACCTGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029870.1-2120s1c1
Sequence:CCGGCATGGCAGTATCTAACCAGTACTCGAGTACTGGTTAGATACTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029870.1-1740s1c1
Sequence:CCGGCCACAGAACTTCTGAGCACAACTCGAGTTGTGCTCAGAAGTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029870.1-79s1c1
Sequence:CCGGCTGAGCCACTTCAAGAGCTTTCTCGAGAAAGCTCTTGAAGTGGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029870.1-2752s1c1
Sequence:CCGGCGAGGAATTGATGAAGCACAACTCGAGTTGTGCTTCATCAATTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029870.1-1513s1c1
Sequence:CCGGGCCAAATTGTCCTCCTCTGATCTCGAGATCAGAGGAGGACAATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029870.1-2753s1c1
Sequence:CCGGGAGGAATTGATGAAGCACAATCTCGAGATTGTGCTTCATCAATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029870
SOWAHB MISSION shRNA Lentiviral Transduction Particles
sosondowah ankyrin repeat domain family member B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029870.1-2075s21c1
Sequence:CCGGGGTTGGCTTCTCGGGTAAATGCTCGAGCATTTACCCGAGAAGCCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029870.1-1629s21c1
Sequence:CCGGTGATGCAGGTTTATCACTAAACTCGAGTTTAGTGATAAACCTGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029870.1-2120s1c1
Sequence:CCGGCATGGCAGTATCTAACCAGTACTCGAGTACTGGTTAGATACTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029870.1-1740s1c1
Sequence:CCGGCCACAGAACTTCTGAGCACAACTCGAGTTGTGCTCAGAAGTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029870.1-79s1c1
Sequence:CCGGCTGAGCCACTTCAAGAGCTTTCTCGAGAAAGCTCTTGAAGTGGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029870.1-2752s1c1
Sequence:CCGGCGAGGAATTGATGAAGCACAACTCGAGTTGTGCTTCATCAATTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029870.1-1513s1c1
Sequence:CCGGGCCAAATTGTCCTCCTCTGATCTCGAGATCAGAGGAGGACAATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029870.1-2753s1c1
Sequence:CCGGGAGGAATTGATGAAGCACAATCTCGAGATTGTGCTTCATCAATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175270
SOWAHB MISSION shRNA Bacterial Glycerol Stock
sosondowah ankyrin repeat domain family member B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175270.4-2570s21c1
Sequence:CCGGGAAACTGTTAGGAGTTGATAACTCGAGTTATCAACTCCTAACAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175270.4-916s21c1
Sequence:CCGGGAGAGCCACTGGAGCTGTTTACTCGAGTAAACAGCTCCAGTGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175270.2-2529s1c1
Sequence:CCGGGCAGTGAAATGGTGTCCTCAACTCGAGTTGAGGACACCATTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175270.2-1964s1c1
Sequence:CCGGGCGGGCATTGCACTAGATGTACTCGAGTACATCTAGTGCAATGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175270.2-1149s1c1
Sequence:CCGGCCGTCTTTCGAAGCATTCGTTCTCGAGAACGAATGCTTCGAAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175270.2-1965s1c1
Sequence:CCGGCGGGCATTGCACTAGATGTAACTCGAGTTACATCTAGTGCAATGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175270.2-2192s1c1
Sequence:CCGGCCTGTCTATTCCTTAGTCCAACTCGAGTTGGACTAAGGAATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175270
SOWAHB MISSION shRNA shRNA Plasmid DNA
sosondowah ankyrin repeat domain family member B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175270.4-2570s21c1
Sequence:CCGGGAAACTGTTAGGAGTTGATAACTCGAGTTATCAACTCCTAACAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175270.4-916s21c1
Sequence:CCGGGAGAGCCACTGGAGCTGTTTACTCGAGTAAACAGCTCCAGTGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175270.2-2529s1c1
Sequence:CCGGGCAGTGAAATGGTGTCCTCAACTCGAGTTGAGGACACCATTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175270.2-1964s1c1
Sequence:CCGGGCGGGCATTGCACTAGATGTACTCGAGTACATCTAGTGCAATGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175270.2-1149s1c1
Sequence:CCGGCCGTCTTTCGAAGCATTCGTTCTCGAGAACGAATGCTTCGAAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175270.2-1965s1c1
Sequence:CCGGCGGGCATTGCACTAGATGTAACTCGAGTTACATCTAGTGCAATGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175270.2-2192s1c1
Sequence:CCGGCCTGTCTATTCCTTAGTCCAACTCGAGTTGGACTAAGGAATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175270
SOWAHB MISSION shRNA Lentiviral Transduction Particles
sosondowah ankyrin repeat domain family member B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175270.4-2570s21c1
Sequence:CCGGGAAACTGTTAGGAGTTGATAACTCGAGTTATCAACTCCTAACAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175270.4-916s21c1
Sequence:CCGGGAGAGCCACTGGAGCTGTTTACTCGAGTAAACAGCTCCAGTGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175270.2-2529s1c1
Sequence:CCGGGCAGTGAAATGGTGTCCTCAACTCGAGTTGAGGACACCATTTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175270.2-1964s1c1
Sequence:CCGGGCGGGCATTGCACTAGATGTACTCGAGTACATCTAGTGCAATGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175270.2-1149s1c1
Sequence:CCGGCCGTCTTTCGAAGCATTCGTTCTCGAGAACGAATGCTTCGAAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175270.2-1965s1c1
Sequence:CCGGCGGGCATTGCACTAGATGTAACTCGAGTTACATCTAGTGCAATGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175270.2-2192s1c1
Sequence:CCGGCCTGTCTATTCCTTAGTCCAACTCGAGTTGGACTAAGGAATAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks