EMAIL THIS PAGE TO A FRIEND

SOWAHC

sosondowah ankyrin repeat domain family member C

Synonyms: ANKRD57 C2orf26
UniProtKB ID: Q53LP3, Q8NE15, Q9H6U1
Gene ID:
Mouse(268301) sosondowah ankyrin repeat domain family member C
Rat(503306) sosondowah ankyrin repeat domain family member C
chicken(428016) sosondowah ankyrin repeat domain family member C
dog(481302) sosondowah ankyrin repeat domain family member C
domestic cat(101095647) sosondowah ankyrin repeat domain family member C
sheep(101110138) sosondowah ankyrin repeat domain family member C
domestic guinea pig(100713751) sosondowah ankyrin repeat domain family member C
naked mole-rat(101723916) sosondowah ankyrin repeat domain family member C
165 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023016 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023016 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023016 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172939 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172939 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172939 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023016 Rosetta Predictions human pricing
NM_001109364 Rosetta Predictions rat pricing
NM_172939 Rosetta Predictions mouse pricing
XM_884335 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096254 predicted 2157
2 SASI_Hs01_00096255 predicted 1417
3 SASI_Hs01_00096256 predicted 2062
4 SASI_Hs01_00096257 predicted 1029
5 SASI_Hs01_00096258 predicted 2143
6 SASI_Hs01_00096260 predicted 1116
7 SASI_Hs01_00096261 predicted 2033
8 SASI_Hs01_00096262 predicted 2033
9 SASI_Hs01_00096263 predicted 1041
10 SASI_Hs02_00356285 predicted 759
11 SASI_Hs01_00096259 predicted 2009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109364 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247704 predicted 1584
2 SASI_Rn02_00247705 predicted 793
3 SASI_Rn02_00247706 predicted 1603
4 SASI_Rn02_00247707 predicted 294
5 SASI_Rn02_00247708 predicted 1620
6 SASI_Rn02_00247709 predicted 1652
7 SASI_Rn02_00247710 predicted 1651
8 SASI_Rn02_00247711 predicted 962
9 SASI_Rn02_00247712 predicted 912
10 SASI_Rn02_00247713 predicted 1209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172939 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344956 predicted 1066
2 SASI_Mm02_00344957 predicted 1893
3 SASI_Mm02_00344958 predicted 1878
4 SASI_Mm02_00344959 predicted 972
5 SASI_Mm02_00344960 predicted 1922
6 SASI_Mm02_00344961 predicted 1202
7 SASI_Mm02_00344962 predicted 820
8 SASI_Mm02_00344963 predicted 1953
9 SASI_Mm02_00344964 predicted 1834
10 SASI_Mm02_00344965 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_884335 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253210 predicted 384
2 SASI_Mm01_00253211 predicted 507
3 SASI_Mm01_00253212 predicted 1365
4 SASI_Mm01_00253213 predicted 1254
5 SASI_Mm01_00253214 predicted 2075
6 SASI_Mm01_00253215 predicted 2066
7 SASI_Mm01_00253216 predicted 2107
8 SASI_Mm01_00253217 predicted 1392
9 SASI_Mm01_00253218 predicted 1003
10 SASI_Mm01_00253219 predicted 2131
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023016
SOWAHC MISSION shRNA Bacterial Glycerol Stock
sosondowah ankyrin repeat domain family member C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023016.1-1014s1c1
Sequence:CCGGGCGGGACTTCATTACCGGCTTCTCGAGAAGCCGGTAATGAAGTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023016.1-348s1c1
Sequence:CCGGCAAGTACGTGCACCTCAAGAACTCGAGTTCTTGAGGTGCACGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023016.2-1560s1c1
Sequence:CCGGGCAGCTCTAGTGGACGTATAACTCGAGTTATACGTCCACTAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023016.2-1714s1c1
Sequence:CCGGGCCCTTCACATTGAGACCAAACTCGAGTTTGGTCTCAATGTGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023016.3-1417s21c1
Sequence:CCGGTCGCATCTCATCACCTACAAACTCGAGTTTGTAGGTGATGAGATGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023016.3-1781s21c1
Sequence:CCGGTTGAATACTAGGTGTTGTAAGCTCGAGCTTACAACACCTAGTATTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023016.3-2067s21c1
Sequence:CCGGGCCTGCAAAGTAAGGAATAATCTCGAGATTATTCCTTACTTTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023016.3-1822s21c1
Sequence:CCGGAGCTAAATTATGCATTCTTACCTCGAGGTAAGAATGCATAATTTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023016.3-1118s21c1
Sequence:CCGGTAGTCAACTTCGCCAACAAACCTCGAGGTTTGTTGGCGAAGTTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023016
SOWAHC MISSION shRNA shRNA Plasmid DNA
sosondowah ankyrin repeat domain family member C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023016.1-1014s1c1
Sequence:CCGGGCGGGACTTCATTACCGGCTTCTCGAGAAGCCGGTAATGAAGTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023016.1-348s1c1
Sequence:CCGGCAAGTACGTGCACCTCAAGAACTCGAGTTCTTGAGGTGCACGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023016.2-1560s1c1
Sequence:CCGGGCAGCTCTAGTGGACGTATAACTCGAGTTATACGTCCACTAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023016.2-1714s1c1
Sequence:CCGGGCCCTTCACATTGAGACCAAACTCGAGTTTGGTCTCAATGTGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023016.3-1417s21c1
Sequence:CCGGTCGCATCTCATCACCTACAAACTCGAGTTTGTAGGTGATGAGATGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023016.3-1781s21c1
Sequence:CCGGTTGAATACTAGGTGTTGTAAGCTCGAGCTTACAACACCTAGTATTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023016.3-2067s21c1
Sequence:CCGGGCCTGCAAAGTAAGGAATAATCTCGAGATTATTCCTTACTTTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023016.3-1822s21c1
Sequence:CCGGAGCTAAATTATGCATTCTTACCTCGAGGTAAGAATGCATAATTTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023016.3-1118s21c1
Sequence:CCGGTAGTCAACTTCGCCAACAAACCTCGAGGTTTGTTGGCGAAGTTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023016
SOWAHC MISSION shRNA Lentiviral Transduction Particles
sosondowah ankyrin repeat domain family member C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023016.1-1014s1c1
Sequence:CCGGGCGGGACTTCATTACCGGCTTCTCGAGAAGCCGGTAATGAAGTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023016.1-348s1c1
Sequence:CCGGCAAGTACGTGCACCTCAAGAACTCGAGTTCTTGAGGTGCACGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023016.2-1560s1c1
Sequence:CCGGGCAGCTCTAGTGGACGTATAACTCGAGTTATACGTCCACTAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023016.2-1714s1c1
Sequence:CCGGGCCCTTCACATTGAGACCAAACTCGAGTTTGGTCTCAATGTGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023016.3-1417s21c1
Sequence:CCGGTCGCATCTCATCACCTACAAACTCGAGTTTGTAGGTGATGAGATGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023016.3-1781s21c1
Sequence:CCGGTTGAATACTAGGTGTTGTAAGCTCGAGCTTACAACACCTAGTATTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023016.3-2067s21c1
Sequence:CCGGGCCTGCAAAGTAAGGAATAATCTCGAGATTATTCCTTACTTTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023016.3-1822s21c1
Sequence:CCGGAGCTAAATTATGCATTCTTACCTCGAGGTAAGAATGCATAATTTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023016.3-1118s21c1
Sequence:CCGGTAGTCAACTTCGCCAACAAACCTCGAGGTTTGTTGGCGAAGTTGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172939
VALIDATED
SOWAHC MISSION shRNA Bacterial Glycerol Stock
sosondowah ankyrin repeat domain family member C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172939.2-2738s1c1
Sequence:CCGGGCCTAGATAGTCTGCCCATTTCTCGAGAAATGGGCAGACTATCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172939.2-1312s1c1
Sequence:CCGGCCCTCACACATCACTCACAAACTCGAGTTTGTGAGTGATGTGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172939.2-1605s1c1
Sequence:CCGGGAGACCGAAGTCCAATGTATTCTCGAGAATACATTGGACTTCGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172939.2-1114s1c1
Sequence:CCGGGTAGAGGTGGTGAAGTTACTACTCGAGTAGTAACTTCACCACCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172939.2-1474s1c1
Sequence:CCGGCGATTCCGAACCCAGATCATTCTCGAGAATGATCTGGGTTCGGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172939.3-1143s21c1
Sequence:CCGGGTAGAGGTGGTGAAGTTACTACTCGAGTAGTAACTTCACCACCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172939.3-1103s21c1
Sequence:CCGGAGGCTACACTGCCCTACATTTCTCGAGAAATGTAGGGCAGTGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172939.3-2073s21c1
Sequence:CCGGACACTTGCTTAAGGTGCTAAACTCGAGTTTAGCACCTTAAGCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172939.3-268s21c1
Sequence:CCGGGCTTCAAGGAACTGGTCAATGCTCGAGCATTGACCAGTTCCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172939.3-615s21c1
Sequence:CCGGGGGTCCAGCGAGAACCTTAAACTCGAGTTTAAGGTTCTCGCTGGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172939
VALIDATED
SOWAHC MISSION shRNA shRNA Plasmid DNA
sosondowah ankyrin repeat domain family member C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172939.2-2738s1c1
Sequence:CCGGGCCTAGATAGTCTGCCCATTTCTCGAGAAATGGGCAGACTATCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172939.2-1312s1c1
Sequence:CCGGCCCTCACACATCACTCACAAACTCGAGTTTGTGAGTGATGTGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172939.2-1605s1c1
Sequence:CCGGGAGACCGAAGTCCAATGTATTCTCGAGAATACATTGGACTTCGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172939.2-1114s1c1
Sequence:CCGGGTAGAGGTGGTGAAGTTACTACTCGAGTAGTAACTTCACCACCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172939.2-1474s1c1
Sequence:CCGGCGATTCCGAACCCAGATCATTCTCGAGAATGATCTGGGTTCGGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172939.3-1143s21c1
Sequence:CCGGGTAGAGGTGGTGAAGTTACTACTCGAGTAGTAACTTCACCACCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172939.3-1103s21c1
Sequence:CCGGAGGCTACACTGCCCTACATTTCTCGAGAAATGTAGGGCAGTGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172939.3-2073s21c1
Sequence:CCGGACACTTGCTTAAGGTGCTAAACTCGAGTTTAGCACCTTAAGCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172939.3-268s21c1
Sequence:CCGGGCTTCAAGGAACTGGTCAATGCTCGAGCATTGACCAGTTCCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172939.3-615s21c1
Sequence:CCGGGGGTCCAGCGAGAACCTTAAACTCGAGTTTAAGGTTCTCGCTGGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172939
VALIDATED
SOWAHC MISSION shRNA Lentiviral Transduction Particles
sosondowah ankyrin repeat domain family member C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172939.2-2738s1c1
Sequence:CCGGGCCTAGATAGTCTGCCCATTTCTCGAGAAATGGGCAGACTATCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172939.2-1312s1c1
Sequence:CCGGCCCTCACACATCACTCACAAACTCGAGTTTGTGAGTGATGTGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172939.2-1605s1c1
Sequence:CCGGGAGACCGAAGTCCAATGTATTCTCGAGAATACATTGGACTTCGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172939.2-1114s1c1
Sequence:CCGGGTAGAGGTGGTGAAGTTACTACTCGAGTAGTAACTTCACCACCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172939.2-1474s1c1
Sequence:CCGGCGATTCCGAACCCAGATCATTCTCGAGAATGATCTGGGTTCGGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172939.3-1143s21c1
Sequence:CCGGGTAGAGGTGGTGAAGTTACTACTCGAGTAGTAACTTCACCACCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172939.3-1103s21c1
Sequence:CCGGAGGCTACACTGCCCTACATTTCTCGAGAAATGTAGGGCAGTGTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172939.3-2073s21c1
Sequence:CCGGACACTTGCTTAAGGTGCTAAACTCGAGTTTAGCACCTTAAGCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172939.3-268s21c1
Sequence:CCGGGCTTCAAGGAACTGGTCAATGCTCGAGCATTGACCAGTTCCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172939.3-615s21c1
Sequence:CCGGGGGTCCAGCGAGAACCTTAAACTCGAGTTTAAGGTTCTCGCTGGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks