EMAIL THIS PAGE TO A FRIEND

SOWAHD

sosondowah ankyrin repeat domain family member D

Synonyms: ANKRD58
UniProtKB ID: A6NJG2
Gene ID:
Mouse(245381) sosondowah ankyrin repeat domain family member D
Rat(367699) sosondowah ankyrin repeat domain family member D
Zebrafish(100884136) sosondowah ankyrin repeat domain family d
naked mole-rat(101700432) sosondowah ankyrin repeat domain family member D
cow(523101) sosondowah ankyrin repeat domain family member D
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173779 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173779 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173779 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001105576 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105576 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105576 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105576 Rosetta Predictions human pricing
XM_293380 Rosetta Predictions human pricing
XM_001062976 Rosetta Predictions rat pricing
XM_346261 Rosetta Predictions rat pricing
NM_173779 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324561 predicted 1200
2 SASI_Hs02_00324562 predicted 988
3 SASI_Hs02_00324563 predicted 1036
4 SASI_Hs02_00324564 predicted 422
5 SASI_Hs02_00324565 predicted 1322
6 SASI_Hs02_00324566 predicted 637
7 SASI_Hs02_00324567 predicted 542
8 SASI_Hs02_00324568 predicted 978
9 SASI_Hs02_00324569 predicted 1248
10 SASI_Hs02_00324570 predicted 1132
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_293380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259829 predicted 657
2 SASI_Hs01_00259830 predicted 340
3 SASI_Hs01_00259831 predicted 673
4 SASI_Hs01_00259832 predicted 561
5 SASI_Hs01_00259833 predicted 606
6 SASI_Hs01_00259834 predicted 720
7 SASI_Hs01_00259835 predicted 393
8 SASI_Hs01_00259836 predicted 708
9 SASI_Hs01_00259837 predicted 668
10 SASI_Hs01_00259838 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062976 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305311 predicted 1456
2 SASI_Rn02_00305312 predicted 1661
3 SASI_Rn02_00305313 predicted 1358
4 SASI_Rn02_00305314 predicted 1306
5 SASI_Rn02_00305315 predicted 1537
6 SASI_Rn02_00305316 predicted 1097
7 SASI_Rn02_00305317 predicted 1604
8 SASI_Rn02_00305318 predicted 1024
9 SASI_Rn02_00305319 predicted 731
10 SASI_Rn02_00305320 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_346261 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399173 predicted 1462
2 SASI_Rn02_00399174 predicted 1665
3 SASI_Rn02_00399175 predicted 1355
4 SASI_Rn02_00399176 predicted 1307
5 SASI_Rn02_00399177 predicted 1542
6 SASI_Rn02_00399178 predicted 1106
7 SASI_Rn02_00399179 predicted 1610
8 SASI_Rn02_00399180 predicted 1023
9 SASI_Rn02_00399181 predicted 734
10 SASI_Rn02_00399182 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180524 predicted 1125
2 SASI_Mm01_00180525 predicted 743
3 SASI_Mm01_00180526 predicted 1114
4 SASI_Mm01_00180527 predicted 963
5 SASI_Mm01_00180528 predicted 1070
6 SASI_Mm01_00180529 predicted 674
7 SASI_Mm01_00180530 predicted 218
8 SASI_Mm01_00180531 predicted 821
9 SASI_Mm01_00180532 predicted 518
10 SASI_Mm02_00345430 predicted 1117
11 SASI_Mm01_00180533 predicted 924
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173779
SOWAHD MISSION shRNA Bacterial Glycerol Stock
sosondowah ankyrin repeat domain family member D
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173779.3-671s21c1
Sequence:CCGGGCTCTGCAAGGCCATGATATGCTCGAGCATATCATGGCCTTGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173779.3-577s21c1
Sequence:CCGGACTCATTCTATTGCACGATTTCTCGAGAAATCGTGCAATAGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173779.3-1392s21c1
Sequence:CCGGATGCAGAGCAAATGCCTAATACTCGAGTATTAGGCATTTGCTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173779.3-177s21c1
Sequence:CCGGATTGCCTTGGCAGGTACAAAGCTCGAGCTTTGTACCTGCCAAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173779.3-750s21c1
Sequence:CCGGGCAATCGACCTTGTCACTATCCTCGAGGATAGTGACAAGGTCGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173779.2-1189s1c1
Sequence:CCGGGCTAGCTAACTGTCACATCAACTCGAGTTGATGTGACAGTTAGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173779.2-752s1c1
Sequence:CCGGCAATCGACCTTGTCACTATCTCTCGAGAGATAGTGACAAGGTCGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173779
SOWAHD MISSION shRNA shRNA Plasmid DNA
sosondowah ankyrin repeat domain family member D
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173779.3-671s21c1
Sequence:CCGGGCTCTGCAAGGCCATGATATGCTCGAGCATATCATGGCCTTGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173779.3-577s21c1
Sequence:CCGGACTCATTCTATTGCACGATTTCTCGAGAAATCGTGCAATAGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173779.3-1392s21c1
Sequence:CCGGATGCAGAGCAAATGCCTAATACTCGAGTATTAGGCATTTGCTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173779.3-177s21c1
Sequence:CCGGATTGCCTTGGCAGGTACAAAGCTCGAGCTTTGTACCTGCCAAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173779.3-750s21c1
Sequence:CCGGGCAATCGACCTTGTCACTATCCTCGAGGATAGTGACAAGGTCGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173779.2-1189s1c1
Sequence:CCGGGCTAGCTAACTGTCACATCAACTCGAGTTGATGTGACAGTTAGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173779.2-752s1c1
Sequence:CCGGCAATCGACCTTGTCACTATCTCTCGAGAGATAGTGACAAGGTCGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173779
SOWAHD MISSION shRNA Lentiviral Transduction Particles
sosondowah ankyrin repeat domain family member D
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173779.3-671s21c1
Sequence:CCGGGCTCTGCAAGGCCATGATATGCTCGAGCATATCATGGCCTTGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173779.3-577s21c1
Sequence:CCGGACTCATTCTATTGCACGATTTCTCGAGAAATCGTGCAATAGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173779.3-1392s21c1
Sequence:CCGGATGCAGAGCAAATGCCTAATACTCGAGTATTAGGCATTTGCTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173779.3-177s21c1
Sequence:CCGGATTGCCTTGGCAGGTACAAAGCTCGAGCTTTGTACCTGCCAAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173779.3-750s21c1
Sequence:CCGGGCAATCGACCTTGTCACTATCCTCGAGGATAGTGACAAGGTCGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173779.2-1189s1c1
Sequence:CCGGGCTAGCTAACTGTCACATCAACTCGAGTTGATGTGACAGTTAGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173779.2-752s1c1
Sequence:CCGGCAATCGACCTTGTCACTATCTCTCGAGAGATAGTGACAAGGTCGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105576
SOWAHD MISSION shRNA Bacterial Glycerol Stock
sosondowah ankyrin repeat domain family member D
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105576.1-810s21c1
Sequence:CCGGGGTGCACCAACCTGAACAACACTCGAGTGTTGTTCAGGTTGGTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105576.1-1373s21c1
Sequence:CCGGTTCGCTAGAAGAATGAGTTAACTCGAGTTAACTCATTCTTCTAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105576.1-544s21c1
Sequence:CCGGGCTCATTCTGGTACACGATTTCTCGAGAAATCGTGTACCAGAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105576.1-986s21c1
Sequence:CCGGTCATTCCAGGACCGTTGACAGCTCGAGCTGTCAACGGTCCTGGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105576.1-948s21c1
Sequence:CCGGTGGCGCAAATGCATAGCCTTTCTCGAGAAAGGCTATGCATTTGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105576
SOWAHD MISSION shRNA shRNA Plasmid DNA
sosondowah ankyrin repeat domain family member D
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105576.1-810s21c1
Sequence:CCGGGGTGCACCAACCTGAACAACACTCGAGTGTTGTTCAGGTTGGTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105576.1-1373s21c1
Sequence:CCGGTTCGCTAGAAGAATGAGTTAACTCGAGTTAACTCATTCTTCTAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105576.1-544s21c1
Sequence:CCGGGCTCATTCTGGTACACGATTTCTCGAGAAATCGTGTACCAGAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105576.1-986s21c1
Sequence:CCGGTCATTCCAGGACCGTTGACAGCTCGAGCTGTCAACGGTCCTGGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105576.1-948s21c1
Sequence:CCGGTGGCGCAAATGCATAGCCTTTCTCGAGAAAGGCTATGCATTTGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105576
SOWAHD MISSION shRNA Lentiviral Transduction Particles
sosondowah ankyrin repeat domain family member D
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105576.1-810s21c1
Sequence:CCGGGGTGCACCAACCTGAACAACACTCGAGTGTTGTTCAGGTTGGTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105576.1-1373s21c1
Sequence:CCGGTTCGCTAGAAGAATGAGTTAACTCGAGTTAACTCATTCTTCTAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105576.1-544s21c1
Sequence:CCGGGCTCATTCTGGTACACGATTTCTCGAGAAATCGTGTACCAGAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105576.1-986s21c1
Sequence:CCGGTCATTCCAGGACCGTTGACAGCTCGAGCTGTCAACGGTCCTGGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105576.1-948s21c1
Sequence:CCGGTGGCGCAAATGCATAGCCTTTCTCGAGAAAGGCTATGCATTTGCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks