EMAIL THIS PAGE TO A FRIEND

SOX10

SRY (sex determining region Y)-box 10

Synonyms: DOM PCWH WS2E WS4 WS4C
UniProtKB ID: P56693
Gene ID:
Human(6663) Summary: This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. This protein acts as a nucleocytoplasmic shuttle protein and is important for neural crest and peripheral nervous system development. Mutations in this gene are associated with Waardenburg-Shah and Waardenburg-Hirschsprung disease. [provided by RefSeq, Jul 2008]
Mouse(20665) SRY-box containing gene 10
Rat(29361) SRY (sex determining region Y)-box 10
naked mole-rat(101712711) SRY (sex determining region Y)-box 10
Domestic Rabbit(100354496) SRY (sex determining region Y)-box 10
domestic guinea pig(100725927) SRY (sex determining region Y)-box 10
cow(353115) SRY (sex determining region Y)-box 10
sheep(101120159) SRY (sex determining region Y)-box 10
Zebrafish(140616) SRY-box containing gene 10
chicken(395573) SRY (sex determining region Y)-box 10
dog(481258) SRY (sex determining region Y)-box 10
domestic cat(101094609) SRY (sex determining region Y)-box 10
Horse(100054980) SRY (sex determining region Y)-box 10
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1710 Human SOX10 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_128139 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_128139 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_128139 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006941 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006941 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006941 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006941 Rosetta Predictions human pricing
NM_019193 Rosetta Predictions rat pricing
XM_128139 Rosetta Predictions mouse pricing
XM_900992 Rosetta Predictions mouse pricing
XM_985075 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068939 predicted 749
2 SASI_Hs01_00068940 predicted 2113
3 SASI_Hs01_00068941 predicted 753
4 SASI_Hs01_00068942 predicted 1115
5 SASI_Hs01_00068943 predicted 2041
6 SASI_Hs01_00068944 predicted 506
7 SASI_Hs02_00342658 predicted 1140
8 SASI_Hs01_00068945 predicted 1320
9 SASI_Hs01_00068946 predicted 2033
10 SASI_Hs01_00068948 predicted 556
11 SASI_Hs01_00068947 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019193 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087692 predicted 1182
2 SASI_Rn01_00087693 predicted 2368
3 SASI_Rn02_00262008 predicted 859
4 SASI_Rn01_00087694 predicted 1944
5 SASI_Rn01_00087695 predicted 812
6 SASI_Rn01_00087696 predicted 2448
7 SASI_Rn02_00262009 predicted 2453
8 SASI_Rn01_00087697 predicted 1941
9 SASI_Rn01_00087700 predicted 1693
10 SASI_Rn01_00087701 predicted 1432
11 SASI_Rn01_00087698 predicted 1252
12 SASI_Rn01_00087699 predicted 909
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244742 predicted 1217
2 SASI_Mm01_00244743 predicted 658
3 SASI_Mm01_00244744 predicted 621
4 SASI_Mm01_00244745 predicted 1239
5 SASI_Mm01_00244746 predicted 1503
6 SASI_Mm01_00244747 predicted 1231
7 SASI_Mm01_00244748 predicted 1244
8 SASI_Mm01_00244749 predicted 1266
9 SASI_Mm01_00244750 predicted 1187
10 SASI_Mm01_00244751 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900992 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239282 predicted 1535
2 SASI_Mm01_00239283 predicted 959
3 SASI_Mm01_00239284 predicted 1132
4 SASI_Mm01_00239285 predicted 1591
5 SASI_Mm01_00239286 predicted 618
6 SASI_Mm01_00239287 predicted 279
7 SASI_Mm01_00239288 predicted 877
8 SASI_Mm01_00239289 predicted 418
9 SASI_Mm01_00239290 predicted 1625
10 SASI_Mm01_00239291 predicted 1539
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_985075 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00448645 predicted 656
2 SASI_Mm02_00448646 predicted 1582
3 SASI_Mm02_00448647 predicted 1754
4 SASI_Mm02_00448648 predicted 1970
5 SASI_Mm02_00448649 predicted 1237
6 SASI_Mm02_00448650 predicted 897
7 SASI_Mm02_00448651 predicted 1048
8 SASI_Mm02_00448652 predicted 1503
9 SASI_Mm02_00448653 predicted 2249
10 SASI_Mm02_00448654 predicted 2099
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_128139
SOX10 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_128139.6-2605s21c1
Sequence:CCGGTTGCTCCAGCGATACCTTAATCTCGAGATTAAGGTATCGCTGGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_128139.6-1758s21c1
Sequence:CCGGGCCAGTATATACGACTCTATCCTCGAGGATAGAGTCGTATATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_128139.6-761s21c1
Sequence:CCGGAGTACCCTCACCTCCACAATGCTCGAGCATTGTGGAGGTGAGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_128139.6-1224s21c1
Sequence:CCGGGGAGATCAGCCACGAGGTAATCTCGAGATTACCTCGTGGCTGATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_128139.6-1603s21c1
Sequence:CCGGCAGCCCTCAGGACCCTATTATCTCGAGATAATAGGGTCCTGAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_128139
SOX10 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_128139.6-2605s21c1
Sequence:CCGGTTGCTCCAGCGATACCTTAATCTCGAGATTAAGGTATCGCTGGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_128139.6-1758s21c1
Sequence:CCGGGCCAGTATATACGACTCTATCCTCGAGGATAGAGTCGTATATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_128139.6-761s21c1
Sequence:CCGGAGTACCCTCACCTCCACAATGCTCGAGCATTGTGGAGGTGAGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_128139.6-1224s21c1
Sequence:CCGGGGAGATCAGCCACGAGGTAATCTCGAGATTACCTCGTGGCTGATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_128139.6-1603s21c1
Sequence:CCGGCAGCCCTCAGGACCCTATTATCTCGAGATAATAGGGTCCTGAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_128139
SOX10 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_128139.6-2605s21c1
Sequence:CCGGTTGCTCCAGCGATACCTTAATCTCGAGATTAAGGTATCGCTGGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_128139.6-1758s21c1
Sequence:CCGGGCCAGTATATACGACTCTATCCTCGAGGATAGAGTCGTATATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_128139.6-761s21c1
Sequence:CCGGAGTACCCTCACCTCCACAATGCTCGAGCATTGTGGAGGTGAGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_128139.6-1224s21c1
Sequence:CCGGGGAGATCAGCCACGAGGTAATCTCGAGATTACCTCGTGGCTGATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_128139.6-1603s21c1
Sequence:CCGGCAGCCCTCAGGACCCTATTATCTCGAGATAATAGGGTCCTGAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006941
SOX10 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 10
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000018984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006941.3-2326s1c1
Sequence:CCGGCCTCATTCTTTGTCTGAGAAACTCGAGTTTCTCAGACAAAGAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006941.3-707s1c1
Sequence:CCGGGCTGCTGAACGAAAGTGACAACTCGAGTTGTCACTTTCGTTCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006941.3-1646s1c1
Sequence:CCGGGCAGCCAGTATATACGACACTCTCGAGAGTGTCGTATATACTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006941
SOX10 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 10
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000018984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006941.3-2326s1c1
Sequence:CCGGCCTCATTCTTTGTCTGAGAAACTCGAGTTTCTCAGACAAAGAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006941.3-707s1c1
Sequence:CCGGGCTGCTGAACGAAAGTGACAACTCGAGTTGTCACTTTCGTTCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006941.3-1646s1c1
Sequence:CCGGGCAGCCAGTATATACGACACTCTCGAGAGTGTCGTATATACTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006941
SOX10 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 10
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000018984    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006941.3-2326s1c1
Sequence:CCGGCCTCATTCTTTGTCTGAGAAACTCGAGTTTCTCAGACAAAGAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006941.3-707s1c1
Sequence:CCGGGCTGCTGAACGAAAGTGACAACTCGAGTTGTCACTTTCGTTCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006941.3-1646s1c1
Sequence:CCGGGCAGCCAGTATATACGACACTCTCGAGAGTGTCGTATATACTGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks