EMAIL THIS PAGE TO A FRIEND

SOX11

SRY (sex determining region Y)-box 11

UniProtKB ID: P35716, Q4ZFV8
Gene ID:
Human(6664) Summary: This intronless gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The protein may function in the developing nervous system and play a role in tumorigenesis. [provided by RefSeq, Jul 2008]
Mouse(20666) SRY-box containing gene 11
Rat(84046) SRY (sex determining region Y)-box 11
cow(781715) SRY-box 11-like
sheep(101123109) SRY (sex determining region Y)-box 11
domestic guinea pig(100730709) SRY (sex determining region Y)-box 11
chicken(396104) SRY (sex determining region Y)-box 11
335 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108484 Anti-SOX11 affinity isolated antibody horse, guinea pig, rabbit, rat, human, mouse, pig
western blot pricing
AV33327 Anti-SOX11 (AB1) antibody produced in rabbit affinity isolated antibody guinea pig, mouse, rat, rabbit, human, horse
western blot pricing
AV38235 Anti-SOX11 (AB2) antibody produced in rabbit affinity isolated antibody guinea pig, human, mouse, rabbit, rat, horse
western blot pricing
SAB4200450 Anti-SOX11 (C-terminal) antibody produced in rabbit IgG fraction of antiserum human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB2501684 Anti-SOX11 antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, pig, human, mouse, rat
ELISA, western blot pricing
S8068 Anti-Sox11 antibody produced in rabbit affinity isolated antibody, ammonium sulfate suspension human, rodent
immunohistochemistry, western blot pricing
HPA000536 Anti-SOX11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4200449 Anti-SOX11 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunofluorescence, immunoprecipitation, western blot pricing
SAB2104072 Anti-SOX11 antibody produced in rabbit affinity isolated antibody rat, horse, human, mouse, guinea pig, rabbit
western blot pricing
SAB4200472 Monoclonal Anti-SOX11 antibody produced in mouse ~1.0 mg/mL, clone SOX11-2, purified immunoglobulin human
western blot pricing
AMAB90502 Monoclonal Anti-SOX11 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0143, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90501 Monoclonal Anti-SOX11 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0142, purified immunoglobulin, buffered aqueous glycerol solution human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003108 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003108 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003108 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009234 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009234 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009234 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138481 MISSION® esiRNA esiRNA human SOX11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003108 Rosetta Predictions human pricing
NM_053349 Rosetta Predictions rat pricing
NM_009234 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143857 predicted 214
2 SASI_Hs01_00143858 predicted 1538
3 SASI_Hs01_00143859 predicted 1817
4 SASI_Hs01_00143860 predicted 695
5 SASI_Hs01_00143861 predicted 323
6 SASI_Hs02_00335075 predicted 67
7 SASI_Hs01_00143862 predicted 854
8 SASI_Hs01_00143863 predicted 177
9 SASI_Hs01_00143864 predicted 891
10 SASI_Hs01_00143865 predicted 1684
11 SASI_Hs01_00143866 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053349 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097920 predicted 1104
2 SASI_Rn02_00265810 predicted 557
3 SASI_Rn01_00097925 predicted 634
4 SASI_Rn01_00097926 predicted 647
5 SASI_Rn02_00265811 predicted 428
6 SASI_Rn02_00265812 predicted 639
7 SASI_Rn02_00265813 predicted 485
8 SASI_Rn02_00265814 predicted 1262
9 SASI_Rn01_00097918 predicted 994
10 SASI_Rn01_00097921 predicted 745
11 SASI_Rn01_00097917 predicted 1253
12 SASI_Rn01_00097919 predicted 865
13 SASI_Rn01_00097922 predicted 589
14 SASI_Rn01_00097923 predicted 867
15 SASI_Rn01_00097924 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009234 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154738 predicted 557
2 SASI_Mm02_00315696 predicted 574
3 SASI_Mm01_00154739 predicted 1102
4 SASI_Mm01_00154740 predicted 574
5 SASI_Mm01_00154742 predicted 858
6 SASI_Mm01_00154743 predicted 633
7 SASI_Mm01_00154744 predicted 1236
8 SASI_Mm01_00154745 predicted 428
9 SASI_Mm01_00154746 predicted 627
10 SASI_Mm02_00315697 predicted 475
11 SASI_Mm01_00154737 predicted 1243
12 SASI_Mm01_00154741 predicted 1188
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003108
SOX11 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003108.3-7305s1c1
Sequence:CCGGGCTCATAATGTTCCATGTATACTCGAGTATACATGGAACATTATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003108.3-982s1c1
Sequence:CCGGCCGCCTCTACTACAGCTTCAACTCGAGTTGAAGCTGTAGTAGAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003108.3-1235s1c1
Sequence:CCGGCTGGTGGATAAGGATTTGGATCTCGAGATCCAAATCCTTATCCACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003108.3-454s1c1
Sequence:CCGGCGCCAGCCAGAGCCCAGAGAACTCGAGTTCTCTGGGCTCTGGCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003108.3-220s1c1
Sequence:CCGGGTTCATGGTATGGTCCAAGATCTCGAGATCTTGGACCATACCATGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003108.3-1142s21c1
Sequence:CCGGTTCGACCTGAGCTTGAATTTCCTCGAGGAAATTCAAGCTCAGGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003108.3-1828s21c1
Sequence:CCGGTTTGAAGCTTGTCGGTCTTTGCTCGAGCAAAGACCGACAAGCTTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003108.3-699s21c1
Sequence:CCGGAGACGGTCAAGTGCGTGTTTCCTCGAGGAAACACGCACTTGACCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003108.3-1690s21c1
Sequence:CCGGTAGTCTGGAGTTGTGATTATTCTCGAGAATAATCACAACTCCAGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003108
SOX11 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003108.3-7305s1c1
Sequence:CCGGGCTCATAATGTTCCATGTATACTCGAGTATACATGGAACATTATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003108.3-982s1c1
Sequence:CCGGCCGCCTCTACTACAGCTTCAACTCGAGTTGAAGCTGTAGTAGAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003108.3-1235s1c1
Sequence:CCGGCTGGTGGATAAGGATTTGGATCTCGAGATCCAAATCCTTATCCACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003108.3-454s1c1
Sequence:CCGGCGCCAGCCAGAGCCCAGAGAACTCGAGTTCTCTGGGCTCTGGCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003108.3-220s1c1
Sequence:CCGGGTTCATGGTATGGTCCAAGATCTCGAGATCTTGGACCATACCATGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003108.3-1142s21c1
Sequence:CCGGTTCGACCTGAGCTTGAATTTCCTCGAGGAAATTCAAGCTCAGGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003108.3-1828s21c1
Sequence:CCGGTTTGAAGCTTGTCGGTCTTTGCTCGAGCAAAGACCGACAAGCTTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003108.3-699s21c1
Sequence:CCGGAGACGGTCAAGTGCGTGTTTCCTCGAGGAAACACGCACTTGACCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003108.3-1690s21c1
Sequence:CCGGTAGTCTGGAGTTGTGATTATTCTCGAGAATAATCACAACTCCAGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003108
SOX11 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003108.3-7305s1c1
Sequence:CCGGGCTCATAATGTTCCATGTATACTCGAGTATACATGGAACATTATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003108.3-982s1c1
Sequence:CCGGCCGCCTCTACTACAGCTTCAACTCGAGTTGAAGCTGTAGTAGAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003108.3-1235s1c1
Sequence:CCGGCTGGTGGATAAGGATTTGGATCTCGAGATCCAAATCCTTATCCACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003108.3-454s1c1
Sequence:CCGGCGCCAGCCAGAGCCCAGAGAACTCGAGTTCTCTGGGCTCTGGCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003108.3-220s1c1
Sequence:CCGGGTTCATGGTATGGTCCAAGATCTCGAGATCTTGGACCATACCATGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003108.3-1142s21c1
Sequence:CCGGTTCGACCTGAGCTTGAATTTCCTCGAGGAAATTCAAGCTCAGGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003108.3-1828s21c1
Sequence:CCGGTTTGAAGCTTGTCGGTCTTTGCTCGAGCAAAGACCGACAAGCTTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003108.3-699s21c1
Sequence:CCGGAGACGGTCAAGTGCGTGTTTCCTCGAGGAAACACGCACTTGACCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003108.3-1690s21c1
Sequence:CCGGTAGTCTGGAGTTGTGATTATTCTCGAGAATAATCACAACTCCAGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009234
VALIDATED
SOX11 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 11
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009234.1-1239s1c1
Sequence:CCGGGTTCGACCTGAGCTTGAATTTCTCGAGAAATTCAAGCTCAGGTCGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009234.1-453s1c1
Sequence:CCGGCTTCATGGTGTGGTCCAAGATCTCGAGATCTTGGACCACACCATGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009234.1-1331s1c1
Sequence:CCGGTGGTGGATAAGGACCTGGATTCTCGAGAATCCAGGTCCTTATCCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009234.1-1092s1c1
Sequence:CCGGGCTGTACTACAGCTTCAAGAACTCGAGTTCTTGAAGCTGTAGTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009234.1-2499s1c1
Sequence:CCGGGCAAATATGTTGGTACGTTATCTCGAGATAACGTACCAACATATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009234.6-866s21c1
Sequence:CCGGTTCCTGGACGACGACGATGAACTCGAGTTCATCGTCGTCGTCCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009234.6-588s21c1
Sequence:CCGGGCGAGAAGATCCCGTTCATCACTCGAGTGATGAACGGGATCTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009234.6-630s21c1
Sequence:CCGGTCAAGCACATGGCTGATTATCCTCGAGGATAATCAGCCATGTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009234.6-1262s21c1
Sequence:CCGGTTCGACCTGAGCTTGAATTTCCTCGAGGAAATTCAAGCTCAGGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009234.6-1476s21c1
Sequence:CCGGCCGACCTGGTGTTCACGTATTCTCGAGAATACGTGAACACCAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009234.6-1114s21c1
Sequence:CCGGGCTCTACTACAGCTTCAAGAACTCGAGTTCTTGAAGCTGTAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009234.6-766s21c1
Sequence:CCGGCAAGAAGTGCGCCAAGCTCAACTCGAGTTGAGCTTGGCGCACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009234
VALIDATED
SOX11 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 11
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009234.1-1239s1c1
Sequence:CCGGGTTCGACCTGAGCTTGAATTTCTCGAGAAATTCAAGCTCAGGTCGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009234.1-453s1c1
Sequence:CCGGCTTCATGGTGTGGTCCAAGATCTCGAGATCTTGGACCACACCATGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009234.1-1331s1c1
Sequence:CCGGTGGTGGATAAGGACCTGGATTCTCGAGAATCCAGGTCCTTATCCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009234.1-1092s1c1
Sequence:CCGGGCTGTACTACAGCTTCAAGAACTCGAGTTCTTGAAGCTGTAGTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009234.1-2499s1c1
Sequence:CCGGGCAAATATGTTGGTACGTTATCTCGAGATAACGTACCAACATATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009234.6-866s21c1
Sequence:CCGGTTCCTGGACGACGACGATGAACTCGAGTTCATCGTCGTCGTCCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009234.6-588s21c1
Sequence:CCGGGCGAGAAGATCCCGTTCATCACTCGAGTGATGAACGGGATCTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009234.6-630s21c1
Sequence:CCGGTCAAGCACATGGCTGATTATCCTCGAGGATAATCAGCCATGTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009234.6-1262s21c1
Sequence:CCGGTTCGACCTGAGCTTGAATTTCCTCGAGGAAATTCAAGCTCAGGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009234.6-1476s21c1
Sequence:CCGGCCGACCTGGTGTTCACGTATTCTCGAGAATACGTGAACACCAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009234.6-1114s21c1
Sequence:CCGGGCTCTACTACAGCTTCAAGAACTCGAGTTCTTGAAGCTGTAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009234.6-766s21c1
Sequence:CCGGCAAGAAGTGCGCCAAGCTCAACTCGAGTTGAGCTTGGCGCACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009234
VALIDATED
SOX11 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 11
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009234.1-1239s1c1
Sequence:CCGGGTTCGACCTGAGCTTGAATTTCTCGAGAAATTCAAGCTCAGGTCGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009234.1-453s1c1
Sequence:CCGGCTTCATGGTGTGGTCCAAGATCTCGAGATCTTGGACCACACCATGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009234.1-1331s1c1
Sequence:CCGGTGGTGGATAAGGACCTGGATTCTCGAGAATCCAGGTCCTTATCCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009234.1-1092s1c1
Sequence:CCGGGCTGTACTACAGCTTCAAGAACTCGAGTTCTTGAAGCTGTAGTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009234.1-2499s1c1
Sequence:CCGGGCAAATATGTTGGTACGTTATCTCGAGATAACGTACCAACATATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009234.6-866s21c1
Sequence:CCGGTTCCTGGACGACGACGATGAACTCGAGTTCATCGTCGTCGTCCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009234.6-588s21c1
Sequence:CCGGGCGAGAAGATCCCGTTCATCACTCGAGTGATGAACGGGATCTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009234.6-630s21c1
Sequence:CCGGTCAAGCACATGGCTGATTATCCTCGAGGATAATCAGCCATGTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009234.6-1262s21c1
Sequence:CCGGTTCGACCTGAGCTTGAATTTCCTCGAGGAAATTCAAGCTCAGGTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009234.6-1476s21c1
Sequence:CCGGCCGACCTGGTGTTCACGTATTCTCGAGAATACGTGAACACCAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009234.6-1114s21c1
Sequence:CCGGGCTCTACTACAGCTTCAAGAACTCGAGTTCTTGAAGCTGTAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009234.6-766s21c1
Sequence:CCGGCAAGAAGTGCGCCAAGCTCAACTCGAGTTGAGCTTGGCGCACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks