EMAIL THIS PAGE TO A FRIEND

SOX12

SRY (sex determining region Y)-box 12

Synonyms: SOX22
UniProtKB ID: O15370, Q5D038, Q9NUD4
Gene ID:
Human(6666) Summary: Members of the SOX family of transcription factors are characterized by the presence of a DNA-binding high mobility group (HMG) domain, homologous to the HMG box of sex-determining region Y (SRY). Forming a subgroup of the HMG domain superfamily, SOX proteins have been implicated in cell fate decisions in a diverse range of developmental processes. SOX transcription factors have diverse tissue-specific expression patterns during early development and have been proposed to act as target-specific transcription factors and/or as chromatin structure regulatory elements. The protein encoded by this gene was identified as a SOX family member based on conserved domains, and its expression in various tissues suggests a role in both differentiation and maintenance of several cell types. [provided by RefSeq, Jan 2013]
Mouse(20667) SRY-box containing gene 12
Rat(689988) SRY (sex determining region Y)-box 12
Zebrafish(562381) SRY (sex determining region Y)-box 12
dog(485820) SRY (sex determining region Y)-box 12
domestic guinea pig(100730390) SRY (sex determining region Y)-box 12
naked mole-rat(101720241) SRY (sex determining region Y)-box 12
248 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1409702 Anti-SOX12 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1411973 ANTI-SOX12 antibody produced in mouse clone 2D3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411974 ANTI-SOX12 antibody produced in mouse clone 4A9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412152 ANTI-SOX12 antibody produced in mouse clone 4A7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2107901 Anti-SOX12 antibody produced in rabbit affinity isolated antibody canine, mouse, guinea pig, rat, human, pig, horse
western blot pricing
AV33330 Anti-SOX12 antibody produced in rabbit affinity isolated antibody, lyophilized powder canine, human, rat, mouse
western blot pricing
SAB4502835 Anti-SOX12 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry pricing
HPA055052 Anti-SOX12 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA061627 Anti-SOX12 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
S7568 Anti-Sox22 antibody produced in rabbit affinity isolated antibody, ammonium sulfate suspension rodent, human
immunohistochemistry, western blot pricing
WH0006666M1 Monoclonal Anti-SOX12 antibody produced in mouse clone 2C4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404396 Monoclonal Anti-SOX12 antibody produced in mouse clone 2A6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011438 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011438 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011438 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006943 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006943 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006943 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU084131 MISSION® esiRNA esiRNA targeting mouse Sox12 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006943 Rosetta Predictions human pricing
XM_001072817 Rosetta Predictions rat pricing
NM_011438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198087 predicted 1619
2 SASI_Hs01_00198088 predicted 4016
3 SASI_Hs01_00198089 predicted 4414
4 SASI_Hs01_00198090 predicted 3974
5 SASI_Hs01_00198091 predicted 4215
6 SASI_Hs01_00198092 predicted 3186
7 SASI_Hs01_00198093 predicted 3175
8 SASI_Hs01_00198094 predicted 3175
9 SASI_Hs01_00198095 predicted 2766
10 SASI_Hs01_00198096 predicted 2574
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072817 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340570 predicted 978
2 SASI_Rn02_00340571 predicted 894
3 SASI_Rn02_00340572 predicted 385
4 SASI_Rn02_00340573 predicted 296
5 SASI_Rn02_00340574 predicted 301
6 SASI_Rn02_00340575 predicted 301
7 SASI_Rn02_00340576 predicted 304
8 SASI_Rn02_00340577 predicted 974
9 SASI_Rn02_00340578 predicted 381
10 SASI_Rn02_00340579 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198978 predicted 453
2 SASI_Mm02_00320667 predicted 3766
3 SASI_Mm01_00198973 predicted 1924
4 SASI_Mm01_00198975 predicted 1899
5 SASI_Mm02_00320668 predicted 3469
6 SASI_Mm01_00198976 predicted 1910
7 SASI_Mm02_00320669 predicted 4260
8 SASI_Mm02_00320670 predicted 3788
9 SASI_Mm02_00320671 predicted 4072
10 SASI_Mm02_00320672 predicted 2189
11 SASI_Mm01_00198974 predicted 1753
12 SASI_Mm01_00198977 predicted 1617
13 SASI_Mm01_00198979 predicted 1729
14 SASI_Mm01_00198980 predicted 1428
15 SASI_Mm01_00198981 predicted 657
16 SASI_Mm01_00198982 predicted 1318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011438
VALIDATED
SOX12 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 12
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011438.2-1672s21c1
Sequence:CCGGTGGGCCTGCCTTGGTAGTTAACTCGAGTTAACTACCAAGGCAGGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011438.2-1565s21c1
Sequence:CCGGCACCTCGTTCCTCCTACATACCTCGAGGTATGTAGGAGGAACGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011438.2-588s21c1
Sequence:CCGGGCTGCAGGACTCGGAGAAGATCTCGAGATCTTCTCCGAGTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011438.2-1184s21c1
Sequence:CCGGCGGGCACGTCACATTTCGAATCTCGAGATTCGAAATGTGACGTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011438.2-1254s21c1
Sequence:CCGGGCGCTCGTCTAGTATCGCCGACTCGAGTCGGCGATACTAGACGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011438.1-1254s1c1
Sequence:CCGGGCGCTCGTCTAGTATCGCCGACTCGAGTCGGCGATACTAGACGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011438.1-1184s1c1
Sequence:CCGGCGGGCACGTCACATTTCGAATCTCGAGATTCGAAATGTGACGTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011438.1-588s1c1
Sequence:CCGGGCTGCAGGACTCGGAGAAGATCTCGAGATCTTCTCCGAGTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011438.1-1048s1c1
Sequence:CCGGGCTACAGCAGAGGAGGGCGAACTCGAGTTCGCCCTCCTCTGCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011438.1-3071s1c1
Sequence:CCGGGCCTTCATTAAGAATGGCAAACTCGAGTTTGCCATTCTTAATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011438
VALIDATED
SOX12 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 12
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011438.2-1672s21c1
Sequence:CCGGTGGGCCTGCCTTGGTAGTTAACTCGAGTTAACTACCAAGGCAGGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011438.2-1565s21c1
Sequence:CCGGCACCTCGTTCCTCCTACATACCTCGAGGTATGTAGGAGGAACGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011438.2-588s21c1
Sequence:CCGGGCTGCAGGACTCGGAGAAGATCTCGAGATCTTCTCCGAGTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011438.2-1184s21c1
Sequence:CCGGCGGGCACGTCACATTTCGAATCTCGAGATTCGAAATGTGACGTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011438.2-1254s21c1
Sequence:CCGGGCGCTCGTCTAGTATCGCCGACTCGAGTCGGCGATACTAGACGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011438.1-1254s1c1
Sequence:CCGGGCGCTCGTCTAGTATCGCCGACTCGAGTCGGCGATACTAGACGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011438.1-1184s1c1
Sequence:CCGGCGGGCACGTCACATTTCGAATCTCGAGATTCGAAATGTGACGTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011438.1-588s1c1
Sequence:CCGGGCTGCAGGACTCGGAGAAGATCTCGAGATCTTCTCCGAGTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011438.1-1048s1c1
Sequence:CCGGGCTACAGCAGAGGAGGGCGAACTCGAGTTCGCCCTCCTCTGCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011438.1-3071s1c1
Sequence:CCGGGCCTTCATTAAGAATGGCAAACTCGAGTTTGCCATTCTTAATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011438
VALIDATED
SOX12 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 12
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011438.2-1672s21c1
Sequence:CCGGTGGGCCTGCCTTGGTAGTTAACTCGAGTTAACTACCAAGGCAGGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011438.2-1565s21c1
Sequence:CCGGCACCTCGTTCCTCCTACATACCTCGAGGTATGTAGGAGGAACGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011438.2-588s21c1
Sequence:CCGGGCTGCAGGACTCGGAGAAGATCTCGAGATCTTCTCCGAGTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011438.2-1184s21c1
Sequence:CCGGCGGGCACGTCACATTTCGAATCTCGAGATTCGAAATGTGACGTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011438.2-1254s21c1
Sequence:CCGGGCGCTCGTCTAGTATCGCCGACTCGAGTCGGCGATACTAGACGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011438.1-1254s1c1
Sequence:CCGGGCGCTCGTCTAGTATCGCCGACTCGAGTCGGCGATACTAGACGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011438.1-1184s1c1
Sequence:CCGGCGGGCACGTCACATTTCGAATCTCGAGATTCGAAATGTGACGTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011438.1-588s1c1
Sequence:CCGGGCTGCAGGACTCGGAGAAGATCTCGAGATCTTCTCCGAGTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011438.1-1048s1c1
Sequence:CCGGGCTACAGCAGAGGAGGGCGAACTCGAGTTCGCCCTCCTCTGCTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011438.1-3071s1c1
Sequence:CCGGGCCTTCATTAAGAATGGCAAACTCGAGTTTGCCATTCTTAATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006943
VALIDATED
SOX12 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006943.2-1242s21c1
Sequence:CCGGCCCGTCTAGCATCGCAGACCTCTCGAGAGGTCTGCGATGCTAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006943.2-3587s21c1
Sequence:CCGGGCCTTTAATGAGGACTAAGAACTCGAGTTCTTAGTCCTCATTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006943.2-630s21c1
Sequence:CCGGCATGGCGGATTACCCGGACTACTCGAGTAGTCCGGGTAATCCGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006943.2-483s21c1
Sequence:CCGGGCAGCACGAACGGCGGAAGATCTCGAGATCTTCCGCCGTTCGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006943.2-483s1c1
Sequence:CCGGGCAGCACGAACGGCGGAAGATCTCGAGATCTTCCGCCGTTCGTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006943.2-630s1c1
Sequence:CCGGCATGGCGGATTACCCGGACTACTCGAGTAGTCCGGGTAATCCGCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006943.2-1083s1c1
Sequence:CCGGGCTGGGCTTTCTGTCCAGGCTCTCGAGAGCCTGGACAGAAAGCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006943.2-3587s1c1
Sequence:CCGGGCCTTTAATGAGGACTAAGAACTCGAGTTCTTAGTCCTCATTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006943
VALIDATED
SOX12 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006943.2-1242s21c1
Sequence:CCGGCCCGTCTAGCATCGCAGACCTCTCGAGAGGTCTGCGATGCTAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006943.2-3587s21c1
Sequence:CCGGGCCTTTAATGAGGACTAAGAACTCGAGTTCTTAGTCCTCATTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006943.2-630s21c1
Sequence:CCGGCATGGCGGATTACCCGGACTACTCGAGTAGTCCGGGTAATCCGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006943.2-483s21c1
Sequence:CCGGGCAGCACGAACGGCGGAAGATCTCGAGATCTTCCGCCGTTCGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006943.2-483s1c1
Sequence:CCGGGCAGCACGAACGGCGGAAGATCTCGAGATCTTCCGCCGTTCGTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006943.2-630s1c1
Sequence:CCGGCATGGCGGATTACCCGGACTACTCGAGTAGTCCGGGTAATCCGCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006943.2-1083s1c1
Sequence:CCGGGCTGGGCTTTCTGTCCAGGCTCTCGAGAGCCTGGACAGAAAGCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006943.2-3587s1c1
Sequence:CCGGGCCTTTAATGAGGACTAAGAACTCGAGTTCTTAGTCCTCATTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006943
VALIDATED
SOX12 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006943.2-1242s21c1
Sequence:CCGGCCCGTCTAGCATCGCAGACCTCTCGAGAGGTCTGCGATGCTAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006943.2-3587s21c1
Sequence:CCGGGCCTTTAATGAGGACTAAGAACTCGAGTTCTTAGTCCTCATTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006943.2-630s21c1
Sequence:CCGGCATGGCGGATTACCCGGACTACTCGAGTAGTCCGGGTAATCCGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006943.2-483s21c1
Sequence:CCGGGCAGCACGAACGGCGGAAGATCTCGAGATCTTCCGCCGTTCGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006943.2-483s1c1
Sequence:CCGGGCAGCACGAACGGCGGAAGATCTCGAGATCTTCCGCCGTTCGTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006943.2-630s1c1
Sequence:CCGGCATGGCGGATTACCCGGACTACTCGAGTAGTCCGGGTAATCCGCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006943.2-1083s1c1
Sequence:CCGGGCTGGGCTTTCTGTCCAGGCTCTCGAGAGCCTGGACAGAAAGCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006943.2-3587s1c1
Sequence:CCGGGCCTTTAATGAGGACTAAGAACTCGAGTTCTTAGTCCTCATTAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks