EMAIL THIS PAGE TO A FRIEND

SOX13

SRY (sex determining region Y)-box 13

Synonyms: ICA12 Sox-13
Gene ID:
Human(9580) Summary: This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. It has also been determined to be a type-1 diabetes autoantigen, also known as islet cell antibody 12. [provided by RefSeq, Jul 2008]
Mouse(20668) SRY-box containing gene 13
Rat(289026) SRY (sex determining region Y)-box 13
cow(788459) SRY (sex determining region Y)-box 13
sheep(101107210) SRY (sex determining region Y)-box 13
naked mole-rat(101726231) SRY (sex determining region Y)-box 13
Domestic Rabbit(100352437) SRY (sex determining region Y)-box 13
domestic guinea pig(100724591) SRY (sex determining region Y)-box 13
chicken(419820) SRY (sex determining region Y)-box 13
domestic cat(101083234) SRY (sex determining region Y)-box 13
dog(488562) SRY (sex determining region Y)-box 13
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011439 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011439 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011439 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005686 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005686 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005686 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005686 Rosetta Predictions human pricing
NM_001105952 Rosetta Predictions rat pricing
NM_011439 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086830 predicted 2726
2 SASI_Hs01_00086831 predicted 2534
3 SASI_Hs01_00086832 predicted 1963
4 SASI_Hs01_00086833 predicted 2496
5 SASI_Hs01_00086834 predicted 894
6 SASI_Hs01_00086835 predicted 1992
7 SASI_Hs01_00086836 predicted 2594
8 SASI_Hs01_00086837 predicted 1841
9 SASI_Hs01_00086838 predicted 2543
10 SASI_Hs01_00086839 predicted 1722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105952 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214162 predicted 1777
2 SASI_Rn02_00214163 predicted 2304
3 SASI_Rn02_00214164 predicted 2600
4 SASI_Rn02_00214165 predicted 2647
5 SASI_Rn02_00214166 predicted 2631
6 SASI_Rn02_00214167 predicted 1687
7 SASI_Rn02_00214168 predicted 1534
8 SASI_Rn02_00214169 predicted 2246
9 SASI_Rn02_00214170 predicted 2277
10 SASI_Rn02_00214171 predicted 1531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011439 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320673 predicted 1842
2 SASI_Mm02_00320674 predicted 634
3 SASI_Mm02_00320675 predicted 2212
4 SASI_Mm02_00320676 predicted 1686
5 SASI_Mm02_00320677 predicted 2241
6 SASI_Mm02_00320678 predicted 1532
7 SASI_Mm02_00320679 predicted 2398
8 SASI_Mm02_00320680 predicted 1610
9 SASI_Mm02_00320681 predicted 2154
10 SASI_Mm01_00058399 predicted 1844
11 SASI_Mm01_00058394 predicted 2244
12 SASI_Mm01_00058395 predicted 1393
13 SASI_Mm01_00058396 predicted 2517
14 SASI_Mm01_00058397 predicted 2606
15 SASI_Mm01_00058398 predicted 1142
16 SASI_Mm01_00058400 predicted 2402
17 SASI_Mm01_00058401 predicted 1952
18 SASI_Mm01_00058402 predicted 1958
19 SASI_Mm01_00058403 predicted 2605
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011439
SOX13 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 13
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011439.1-2923s1c1
Sequence:CCGGCCTGGTTGTATCCCAAGGAAACTCGAGTTTCCTTGGGATACAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011439.1-1963s1c1
Sequence:CCGGCACTTGTAGATACATTCCCAACTCGAGTTGGGAATGTATCTACAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011439.1-1962s1c1
Sequence:CCGGGCACTTGTAGATACATTCCCACTCGAGTGGGAATGTATCTACAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011439.1-539s1c1
Sequence:CCGGGCTGATTCAACAGCAGCACAACTCGAGTTGTGCTGCTGTTGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011439.1-666s1c1
Sequence:CCGGGCTTTACCTATTCAGCCCATTCTCGAGAATGGGCTGAATAGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011439.2-1582s21c1
Sequence:CCGGACATCAAGAGACCCATGAATGCTCGAGCATTCATGGGTCTCTTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011439.2-622s21c1
Sequence:CCGGTGGACTTCAACCGCAACTTACCTCGAGGTAAGTTGCGGTTGAAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011439
SOX13 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 13
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011439.1-2923s1c1
Sequence:CCGGCCTGGTTGTATCCCAAGGAAACTCGAGTTTCCTTGGGATACAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011439.1-1963s1c1
Sequence:CCGGCACTTGTAGATACATTCCCAACTCGAGTTGGGAATGTATCTACAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011439.1-1962s1c1
Sequence:CCGGGCACTTGTAGATACATTCCCACTCGAGTGGGAATGTATCTACAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011439.1-539s1c1
Sequence:CCGGGCTGATTCAACAGCAGCACAACTCGAGTTGTGCTGCTGTTGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011439.1-666s1c1
Sequence:CCGGGCTTTACCTATTCAGCCCATTCTCGAGAATGGGCTGAATAGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011439.2-1582s21c1
Sequence:CCGGACATCAAGAGACCCATGAATGCTCGAGCATTCATGGGTCTCTTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011439.2-622s21c1
Sequence:CCGGTGGACTTCAACCGCAACTTACCTCGAGGTAAGTTGCGGTTGAAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011439
SOX13 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 13
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011439.1-2923s1c1
Sequence:CCGGCCTGGTTGTATCCCAAGGAAACTCGAGTTTCCTTGGGATACAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011439.1-1963s1c1
Sequence:CCGGCACTTGTAGATACATTCCCAACTCGAGTTGGGAATGTATCTACAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011439.1-1962s1c1
Sequence:CCGGGCACTTGTAGATACATTCCCACTCGAGTGGGAATGTATCTACAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011439.1-539s1c1
Sequence:CCGGGCTGATTCAACAGCAGCACAACTCGAGTTGTGCTGCTGTTGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011439.1-666s1c1
Sequence:CCGGGCTTTACCTATTCAGCCCATTCTCGAGAATGGGCTGAATAGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011439.2-1582s21c1
Sequence:CCGGACATCAAGAGACCCATGAATGCTCGAGCATTCATGGGTCTCTTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011439.2-622s21c1
Sequence:CCGGTGGACTTCAACCGCAACTTACCTCGAGGTAAGTTGCGGTTGAAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005686
SOX13 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 13
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005686.2-2539s1c1
Sequence:CCGGCCTAAGACTATGTTGGTACTTCTCGAGAAGTACCAACATAGTCTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005686.2-895s1c1
Sequence:CCGGGAAGCTGGACTTCAACCGAAACTCGAGTTTCGGTTGAAGTCCAGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005686.2-1996s1c1
Sequence:CCGGCCAGGAGAAGCAGCCCTACTACTCGAGTAGTAGGGCTGCTTCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005686.2-1252s1c1
Sequence:CCGGCCAGCAGGTTAACATGCCTTACTCGAGTAAGGCATGTTAACCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005686.2-983s1c1
Sequence:CCGGAGGAACTCTATGGAAGCCAAACTCGAGTTTGGCTTCCATAGAGTTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005686.2-1359s21c1
Sequence:CCGGCCTGCAAACCAGTGGAGTATCCTCGAGGATACTCCACTGGTTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005686.2-2702s21c1
Sequence:CCGGACCTCAGCCTTTAGGGCTTATCTCGAGATAAGCCCTAAAGGCTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005686.2-2949s21c1
Sequence:CCGGTTCATCTCTGCCAAGCCTATTCTCGAGAATAGGCTTGGCAGAGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005686.2-1044s21c1
Sequence:CCGGTCCAGCTTCTGGTCATGATTCCTCGAGGAATCATGACCAGAAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005686.2-2891s21c1
Sequence:CCGGTCTATCACCAGGATCGCTTTGCTCGAGCAAAGCGATCCTGGTGATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005686
SOX13 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 13
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005686.2-2539s1c1
Sequence:CCGGCCTAAGACTATGTTGGTACTTCTCGAGAAGTACCAACATAGTCTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005686.2-895s1c1
Sequence:CCGGGAAGCTGGACTTCAACCGAAACTCGAGTTTCGGTTGAAGTCCAGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005686.2-1996s1c1
Sequence:CCGGCCAGGAGAAGCAGCCCTACTACTCGAGTAGTAGGGCTGCTTCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005686.2-1252s1c1
Sequence:CCGGCCAGCAGGTTAACATGCCTTACTCGAGTAAGGCATGTTAACCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005686.2-983s1c1
Sequence:CCGGAGGAACTCTATGGAAGCCAAACTCGAGTTTGGCTTCCATAGAGTTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005686.2-1359s21c1
Sequence:CCGGCCTGCAAACCAGTGGAGTATCCTCGAGGATACTCCACTGGTTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005686.2-2702s21c1
Sequence:CCGGACCTCAGCCTTTAGGGCTTATCTCGAGATAAGCCCTAAAGGCTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005686.2-2949s21c1
Sequence:CCGGTTCATCTCTGCCAAGCCTATTCTCGAGAATAGGCTTGGCAGAGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005686.2-1044s21c1
Sequence:CCGGTCCAGCTTCTGGTCATGATTCCTCGAGGAATCATGACCAGAAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005686.2-2891s21c1
Sequence:CCGGTCTATCACCAGGATCGCTTTGCTCGAGCAAAGCGATCCTGGTGATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005686
SOX13 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 13
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005686.2-2539s1c1
Sequence:CCGGCCTAAGACTATGTTGGTACTTCTCGAGAAGTACCAACATAGTCTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005686.2-895s1c1
Sequence:CCGGGAAGCTGGACTTCAACCGAAACTCGAGTTTCGGTTGAAGTCCAGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005686.2-1996s1c1
Sequence:CCGGCCAGGAGAAGCAGCCCTACTACTCGAGTAGTAGGGCTGCTTCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005686.2-1252s1c1
Sequence:CCGGCCAGCAGGTTAACATGCCTTACTCGAGTAAGGCATGTTAACCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005686.2-983s1c1
Sequence:CCGGAGGAACTCTATGGAAGCCAAACTCGAGTTTGGCTTCCATAGAGTTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005686.2-1359s21c1
Sequence:CCGGCCTGCAAACCAGTGGAGTATCCTCGAGGATACTCCACTGGTTTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005686.2-2702s21c1
Sequence:CCGGACCTCAGCCTTTAGGGCTTATCTCGAGATAAGCCCTAAAGGCTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005686.2-2949s21c1
Sequence:CCGGTTCATCTCTGCCAAGCCTATTCTCGAGAATAGGCTTGGCAGAGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005686.2-1044s21c1
Sequence:CCGGTCCAGCTTCTGGTCATGATTCCTCGAGGAATCATGACCAGAAGCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005686.2-2891s21c1
Sequence:CCGGTCTATCACCAGGATCGCTTTGCTCGAGCAAAGCGATCCTGGTGATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks