EMAIL THIS PAGE TO A FRIEND

SOX14

SRY (sex determining region Y)-box 14

Synonyms: SOX28
UniProtKB ID: O95416, B2RAC0, Q3KPH7
Gene ID:
Human(8403) Summary: This intronless gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. Mutations in this gene are suggested to be responsible for the limb defects associated with blepharophimosis, ptosis, epicanthus inversus syndrome (BPES) and Mobius syndrome. [provided by RefSeq, Jul 2008]
Mouse(20669) SRY-box containing gene 14
Rat(300954) SRY (sex determining region Y)-box 14
fruit fly(37822) Sox box protein 14
Zebrafish(557661) SRY-box containing gene 14
chicken(395526) SRY (sex determining region Y)-box 14
dog(485682) SRY (sex determining region Y)-box 14
dog(100683300) SRY (sex determining region Y)-box 14
domestic cat(101094445) SRY (sex determining region Y)-box 14
domestic guinea pig(100730667) SRY (sex determining region Y)-box 14
naked mole-rat(101704710) SRY (sex determining region Y)-box 14
cow(504604) SRY (sex determining region Y)-box 14
sheep(101112787) SRY (sex determining region Y)-box 14
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV35711 Anti-SOX14 (AB1) antibody produced in rabbit IgG fraction of antiserum bovine, rabbit, mouse, human, rat, guinea pig, zebrafish, canine
western blot pricing
AV35712 Anti-SOX14 (AB2) antibody produced in rabbit IgG fraction of antiserum bovine, rabbit, canine, human, zebrafish, rat, mouse, guinea pig
western blot pricing
S7818 Anti-Sox14 antibody produced in rabbit affinity isolated antibody, ammonium sulfate suspension rodent, human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004189 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004189 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004189 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_284529 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_284529 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_284529 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004189 Rosetta Predictions human pricing
NM_001106850 Rosetta Predictions rat pricing
XM_236605 Rosetta Predictions rat pricing
XM_284529 Rosetta Predictions mouse pricing
XM_907434 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337077 predicted 274
2 SASI_Hs01_00150258 predicted 403
3 SASI_Hs01_00150259 predicted 396
4 SASI_Hs01_00150260 predicted 202
5 SASI_Hs01_00150261 predicted 547
6 SASI_Hs01_00150262 predicted 523
7 SASI_Hs01_00150263 predicted 472
8 SASI_Hs01_00150264 predicted 302
9 SASI_Hs01_00150265 predicted 233
10 SASI_Hs02_00337078 predicted 213
11 SASI_Hs01_00150266 predicted 243
12 SASI_Hs01_00150267 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106850 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223016 predicted 798
2 SASI_Rn02_00223017 predicted 735
3 SASI_Rn02_00223018 predicted 537
4 SASI_Rn02_00223019 predicted 965
5 SASI_Rn02_00223020 predicted 1137
6 SASI_Rn02_00223021 predicted 726
7 SASI_Rn02_00223022 predicted 537
8 SASI_Rn02_00223023 predicted 1052
9 SASI_Rn02_00223024 predicted 527
10 SASI_Rn02_00223025 predicted 973
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236605 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00136055 predicted 240
2 SASI_Rn01_00136056 predicted 983
3 SASI_Rn01_00136057 predicted 914
4 SASI_Rn01_00136058 predicted 720
5 SASI_Rn01_00136059 predicted 1143
6 SASI_Rn01_00136060 predicted 1238
7 SASI_Rn01_00136061 predicted 372
8 SASI_Rn01_00136062 predicted 404
9 SASI_Rn01_00136063 predicted 1152
10 SASI_Rn01_00136064 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_284529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425668 predicted 1602
2 SASI_Mm02_00425669 predicted 50
3 SASI_Mm01_00225226 predicted 367
4 SASI_Mm02_00425670 predicted 1589
5 SASI_Mm01_00225227 predicted 1283
6 SASI_Mm01_00225228 predicted 942
7 SASI_Mm01_00225229 predicted 1369
8 SASI_Mm02_00425671 predicted 149
9 SASI_Mm01_00225230 predicted 304
10 SASI_Mm01_00225231 predicted 1866
11 SASI_Mm01_00225222 predicted 1652
12 SASI_Mm01_00225223 predicted 1312
13 SASI_Mm01_00225224 predicted 32
14 SASI_Mm01_00225225 predicted 1466
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433332 predicted 1311
2 SASI_Mm02_00433333 predicted 970
3 SASI_Mm02_00433334 predicted 712
4 SASI_Mm02_00433335 predicted 900
5 SASI_Mm02_00433336 predicted 909
6 SASI_Mm02_00433337 predicted 796
7 SASI_Mm02_00433338 predicted 1228
8 SASI_Mm02_00433339 predicted 362
9 SASI_Mm02_00433340 predicted 1321
10 SASI_Mm02_00433341 predicted 1143
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004189
SOX14 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 14
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004189.2-173s21c1
Sequence:CCGGTAGGTGCCGAATGGAAGCTTCCTCGAGGAAGCTTCCATTCGGCACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004189.2-727s21c1
Sequence:CCGGACTGGCATAGACCCTTATTCGCTCGAGCGAATAAGGGTCTATGCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004189.2-181s21c1
Sequence:CCGGGAATGGAAGCTTCTGTCCGAGCTCGAGCTCGGACAGAAGCTTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004189.2-213s1c1
Sequence:CCGGGCCATACATCGATGAAGCCAACTCGAGTTGGCTTCATCGATGTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004189.2-306s1c1
Sequence:CCGGGCTCAAGAAGGACAGGTATGTCTCGAGACATACCTGTCCTTCTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004189.2-650s1c1
Sequence:CCGGCCTGTAACTGTACCGCCTGGTCTCGAGACCAGGCGGTACAGTTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004189.2-634s1c1
Sequence:CCGGCCTGGCTACGTGGTGCCCTGTCTCGAGACAGGGCACCACGTAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004189.2-164s1c1
Sequence:CCGGGCAAACGCCTAGGTGCCGAATCTCGAGATTCGGCACCTAGGCGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004189
SOX14 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 14
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004189.2-173s21c1
Sequence:CCGGTAGGTGCCGAATGGAAGCTTCCTCGAGGAAGCTTCCATTCGGCACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004189.2-727s21c1
Sequence:CCGGACTGGCATAGACCCTTATTCGCTCGAGCGAATAAGGGTCTATGCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004189.2-181s21c1
Sequence:CCGGGAATGGAAGCTTCTGTCCGAGCTCGAGCTCGGACAGAAGCTTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004189.2-213s1c1
Sequence:CCGGGCCATACATCGATGAAGCCAACTCGAGTTGGCTTCATCGATGTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004189.2-306s1c1
Sequence:CCGGGCTCAAGAAGGACAGGTATGTCTCGAGACATACCTGTCCTTCTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004189.2-650s1c1
Sequence:CCGGCCTGTAACTGTACCGCCTGGTCTCGAGACCAGGCGGTACAGTTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004189.2-634s1c1
Sequence:CCGGCCTGGCTACGTGGTGCCCTGTCTCGAGACAGGGCACCACGTAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004189.2-164s1c1
Sequence:CCGGGCAAACGCCTAGGTGCCGAATCTCGAGATTCGGCACCTAGGCGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004189
SOX14 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 14
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004189.2-173s21c1
Sequence:CCGGTAGGTGCCGAATGGAAGCTTCCTCGAGGAAGCTTCCATTCGGCACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004189.2-727s21c1
Sequence:CCGGACTGGCATAGACCCTTATTCGCTCGAGCGAATAAGGGTCTATGCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004189.2-181s21c1
Sequence:CCGGGAATGGAAGCTTCTGTCCGAGCTCGAGCTCGGACAGAAGCTTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004189.2-213s1c1
Sequence:CCGGGCCATACATCGATGAAGCCAACTCGAGTTGGCTTCATCGATGTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004189.2-306s1c1
Sequence:CCGGGCTCAAGAAGGACAGGTATGTCTCGAGACATACCTGTCCTTCTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004189.2-650s1c1
Sequence:CCGGCCTGTAACTGTACCGCCTGGTCTCGAGACCAGGCGGTACAGTTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004189.2-634s1c1
Sequence:CCGGCCTGGCTACGTGGTGCCCTGTCTCGAGACAGGGCACCACGTAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004189.2-164s1c1
Sequence:CCGGGCAAACGCCTAGGTGCCGAATCTCGAGATTCGGCACCTAGGCGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_284529
SOX14 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_284529.7-851s21c1
Sequence:CCGGAGCGGCCTTACATCGATGAAGCTCGAGCTTCATCGATGTAAGGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_284529.7-176s21c1
Sequence:CCGGCGCATCGGCCAGGCAATTATTCTCGAGAATAATTGCCTGGCCGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_284529.7-44s21c1
Sequence:CCGGCCTATCTCAAGCTGGTGAAAGCTCGAGCTTTCACCAGCTTGAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_284529.7-503s21c1
Sequence:CCGGGGGACTGGCATGATCAGTTGACTCGAGTCAACTGATCATGCCAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_284529.7-1967s21c1
Sequence:CCGGGGTCGTGTTTGCTTCGATAAACTCGAGTTTATCGAAGCAAACACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_284529
SOX14 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_284529.7-851s21c1
Sequence:CCGGAGCGGCCTTACATCGATGAAGCTCGAGCTTCATCGATGTAAGGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_284529.7-176s21c1
Sequence:CCGGCGCATCGGCCAGGCAATTATTCTCGAGAATAATTGCCTGGCCGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_284529.7-44s21c1
Sequence:CCGGCCTATCTCAAGCTGGTGAAAGCTCGAGCTTTCACCAGCTTGAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_284529.7-503s21c1
Sequence:CCGGGGGACTGGCATGATCAGTTGACTCGAGTCAACTGATCATGCCAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_284529.7-1967s21c1
Sequence:CCGGGGTCGTGTTTGCTTCGATAAACTCGAGTTTATCGAAGCAAACACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_284529
SOX14 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_284529.7-851s21c1
Sequence:CCGGAGCGGCCTTACATCGATGAAGCTCGAGCTTCATCGATGTAAGGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_284529.7-176s21c1
Sequence:CCGGCGCATCGGCCAGGCAATTATTCTCGAGAATAATTGCCTGGCCGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_284529.7-44s21c1
Sequence:CCGGCCTATCTCAAGCTGGTGAAAGCTCGAGCTTTCACCAGCTTGAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_284529.7-503s21c1
Sequence:CCGGGGGACTGGCATGATCAGTTGACTCGAGTCAACTGATCATGCCAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_284529.7-1967s21c1
Sequence:CCGGGGTCGTGTTTGCTTCGATAAACTCGAGTTTATCGAAGCAAACACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks