EMAIL THIS PAGE TO A FRIEND

SOX15

SRY (sex determining region Y)-box 15

Synonyms: SOX20 SOX26 SOX27
UniProtKB ID: O60248, D3DTQ0, P35717, Q9Y6W7
Gene ID:
Human(6665) Summary: This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. [provided by RefSeq, Jul 2008]
Mouse(20670) SRY-box containing gene 15
Rat(363632) SRY (sex determining region Y)-box 15
cow(505878) SRY (sex determining region Y)-box 15
sheep(101102744) SRY (sex determining region Y)-box 15
naked mole-rat(101699264) SRY (sex determining region Y)-box 15
domestic guinea pig(100735819) SRY (sex determining region Y)-box 15
fruit fly(36575) Sox box protein 15
dog(100688349) SRY (sex determining region Y)-box 15
domestic cat(101099001) SRY (sex determining region Y)-box 15
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102265 Anti-SOX15 (ab1) antibody produced in rabbit affinity isolated antibody bovine, horse, canine, human
western blot pricing
AV38882 Anti-SOX15 (AB1) antibody produced in rabbit IgG fraction of antiserum guinea pig, human, horse, rabbit
western blot pricing
SAB2102266 Anti-SOX15 (ab2) antibody produced in rabbit affinity isolated antibody human, mouse, rabbit, canine, bovine, guinea pig
western blot pricing
AV38883 Anti-SOX15 (AB2) antibody produced in rabbit IgG fraction of antiserum guinea pig, rat, human, mouse, bovine, canine, horse
immunohistochemistry, western blot pricing
GW21259 Anti-SOX15 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2500980 Anti-SOX15 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
HPA067196 Anti-SOX15 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA074049 Anti-SOX15 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB1404395 Monoclonal Anti-SOX15 antibody produced in mouse clone 1B3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1402362 Monoclonal Anti-SOX15 antibody produced in mouse clone 2C1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1711 Human SOX15 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006942 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006942 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006942 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009235 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009235 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009235 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006942 Rosetta Predictions human pricing
NM_001108830 Rosetta Predictions rat pricing
NM_009235 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035896 predicted 1089
2 SASI_Hs01_00035897 predicted 649
3 SASI_Hs01_00035898 predicted 1000
4 SASI_Hs01_00035899 predicted 1020
5 SASI_Hs01_00035900 predicted 882
6 SASI_Hs01_00035901 predicted 987
7 SASI_Hs01_00035902 predicted 1099
8 SASI_Hs01_00035903 predicted 495
9 SASI_Hs01_00035904 predicted 993
10 SASI_Hs01_00035905 predicted 1272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108830 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242495 predicted 406
2 SASI_Rn02_00242496 predicted 455
3 SASI_Rn02_00242497 predicted 491
4 SASI_Rn02_00242498 predicted 399
5 SASI_Rn02_00242499 predicted 472
6 SASI_Rn02_00242500 predicted 495
7 SASI_Rn02_00242501 predicted 528
8 SASI_Rn02_00242502 predicted 525
9 SASI_Rn02_00242503 predicted 525
10 SASI_Rn02_00242504 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009235 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101936 predicted 458
2 SASI_Mm01_00101937 predicted 257
3 SASI_Mm01_00101938 predicted 324
4 SASI_Mm01_00101939 predicted 314
5 SASI_Mm01_00101940 predicted 275
6 SASI_Mm01_00101941 predicted 293
7 SASI_Mm01_00101942 predicted 252
8 SASI_Mm01_00101943 predicted 404
9 SASI_Mm01_00101944 predicted 458
10 SASI_Mm01_00101945 predicted 458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006942
SOX15 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 15
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006942.1-746s1c1
Sequence:CCGGCGCGCAGTGGAAGCTGCTGGACTCGAGTCCAGCAGCTTCCACTGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006942.1-1029s1c1
Sequence:CCGGTCTTCCCACTGCAAACTGGAACTCGAGTTCCAGTTTGCAGTGGGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006942.1-966s1c1
Sequence:CCGGAGCAGAGGCTTTGGGTACAGACTCGAGTCTGTACCCAAAGCCTCTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006942.1-993s21c1
Sequence:CCGGAGCTACTCGACAGCCTACCTGCTCGAGCAGGTAGGCTGTCGAGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006942.1-1012s21c1
Sequence:CCGGTGCCTGGCAGCTATGGCTCTTCTCGAGAAGAGCCATAGCTGCCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006942.1-1183s21c1
Sequence:CCGGTAACCCACCTCTAACCCTCATCTCGAGATGAGGGTTAGAGGTGGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006942
SOX15 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 15
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006942.1-746s1c1
Sequence:CCGGCGCGCAGTGGAAGCTGCTGGACTCGAGTCCAGCAGCTTCCACTGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006942.1-1029s1c1
Sequence:CCGGTCTTCCCACTGCAAACTGGAACTCGAGTTCCAGTTTGCAGTGGGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006942.1-966s1c1
Sequence:CCGGAGCAGAGGCTTTGGGTACAGACTCGAGTCTGTACCCAAAGCCTCTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006942.1-993s21c1
Sequence:CCGGAGCTACTCGACAGCCTACCTGCTCGAGCAGGTAGGCTGTCGAGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006942.1-1012s21c1
Sequence:CCGGTGCCTGGCAGCTATGGCTCTTCTCGAGAAGAGCCATAGCTGCCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006942.1-1183s21c1
Sequence:CCGGTAACCCACCTCTAACCCTCATCTCGAGATGAGGGTTAGAGGTGGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006942
SOX15 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 15
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006942.1-746s1c1
Sequence:CCGGCGCGCAGTGGAAGCTGCTGGACTCGAGTCCAGCAGCTTCCACTGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006942.1-1029s1c1
Sequence:CCGGTCTTCCCACTGCAAACTGGAACTCGAGTTCCAGTTTGCAGTGGGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006942.1-966s1c1
Sequence:CCGGAGCAGAGGCTTTGGGTACAGACTCGAGTCTGTACCCAAAGCCTCTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006942.1-993s21c1
Sequence:CCGGAGCTACTCGACAGCCTACCTGCTCGAGCAGGTAGGCTGTCGAGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006942.1-1012s21c1
Sequence:CCGGTGCCTGGCAGCTATGGCTCTTCTCGAGAAGAGCCATAGCTGCCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006942.1-1183s21c1
Sequence:CCGGTAACCCACCTCTAACCCTCATCTCGAGATGAGGGTTAGAGGTGGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009235
SOX15 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 15
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009235.1-442s1c1
Sequence:CCGGCCAGGGTACACAACTACCCAACTCGAGTTGGGTAGTTGTGTACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009235.1-324s1c1
Sequence:CCGGCCGCGACTATCCCGACTACAACTCGAGTTGTAGTCGGGATAGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009235.1-266s1c1
Sequence:CCGGGCGATGAAGAGAAGCGACCCTCTCGAGAGGGTCGCTTCTCTTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009235.1-38s1c1
Sequence:CCGGGCCTGCATCCTCGGGCTTCCACTCGAGTGGAAGCCCGAGGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009235.1-512s1c1
Sequence:CCGGTGCCTGGCAGTTACACCTCTTCTCGAGAAGAGGTGTAACTGCCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009235.1-494s21c1
Sequence:CCGGACTATTCGACAGCCTACCTGCCTCGAGGCAGGTAGGCTGTCGAATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009235.1-293s21c1
Sequence:CCGGAGGAGGCTAAGCGTCTTCGTGCTCGAGCACGAAGACGCTTAGCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009235
SOX15 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 15
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009235.1-442s1c1
Sequence:CCGGCCAGGGTACACAACTACCCAACTCGAGTTGGGTAGTTGTGTACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009235.1-324s1c1
Sequence:CCGGCCGCGACTATCCCGACTACAACTCGAGTTGTAGTCGGGATAGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009235.1-266s1c1
Sequence:CCGGGCGATGAAGAGAAGCGACCCTCTCGAGAGGGTCGCTTCTCTTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009235.1-38s1c1
Sequence:CCGGGCCTGCATCCTCGGGCTTCCACTCGAGTGGAAGCCCGAGGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009235.1-512s1c1
Sequence:CCGGTGCCTGGCAGTTACACCTCTTCTCGAGAAGAGGTGTAACTGCCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009235.1-494s21c1
Sequence:CCGGACTATTCGACAGCCTACCTGCCTCGAGGCAGGTAGGCTGTCGAATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009235.1-293s21c1
Sequence:CCGGAGGAGGCTAAGCGTCTTCGTGCTCGAGCACGAAGACGCTTAGCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009235
SOX15 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 15
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009235.1-442s1c1
Sequence:CCGGCCAGGGTACACAACTACCCAACTCGAGTTGGGTAGTTGTGTACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009235.1-324s1c1
Sequence:CCGGCCGCGACTATCCCGACTACAACTCGAGTTGTAGTCGGGATAGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009235.1-266s1c1
Sequence:CCGGGCGATGAAGAGAAGCGACCCTCTCGAGAGGGTCGCTTCTCTTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009235.1-38s1c1
Sequence:CCGGGCCTGCATCCTCGGGCTTCCACTCGAGTGGAAGCCCGAGGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009235.1-512s1c1
Sequence:CCGGTGCCTGGCAGTTACACCTCTTCTCGAGAAGAGGTGTAACTGCCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009235.1-494s21c1
Sequence:CCGGACTATTCGACAGCCTACCTGCCTCGAGGCAGGTAGGCTGTCGAATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009235.1-293s21c1
Sequence:CCGGAGGAGGCTAAGCGTCTTCGTGCTCGAGCACGAAGACGCTTAGCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks