EMAIL THIS PAGE TO A FRIEND

SOX17

SRY (sex determining region Y)-box 17

Synonyms: VUR3
UniProtKB ID: Q9H6I2
Gene ID:
Human(64321) Summary: This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. [provided by RefSeq, Jul 2008]
Mouse(20671) SRY-box containing gene 17
Rat(312936) SRY (sex determining region Y)-box 17
cow(534010) SRY (sex determining region Y)-box 17
sheep(101108236) SRY (sex determining region Y)-box 17
domestic guinea pig(100719584) SRY (sex determining region Y)-box 17
naked mole-rat(101708706) SRY (sex determining region Y)-box 17
Zebrafish(30544) SRY-box containing gene 17
dog(486955) SRY (sex determining region Y)-box 17
chicken(428534) SRY (sex determining region Y)-box 17
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1712 Human SOX17 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022454 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022454 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022454 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011441 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011441 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011441 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049201 MISSION® esiRNA esiRNA human SOX17 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022454 Rosetta Predictions human pricing
NM_001107902 Rosetta Predictions rat pricing
NM_011441 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021141 predicted 1574
2 SASI_Hs01_00021142 predicted 1413
3 SASI_Hs02_00355717 predicted 1924
4 SASI_Hs01_00021143 predicted 1346
5 SASI_Hs01_00021144 predicted 801
6 SASI_Hs02_00355718 predicted 1904
7 SASI_Hs02_00355719 predicted 1764
8 SASI_Hs02_00355720 predicted 1878
9 SASI_Hs02_00355721 predicted 1680
10 SASI_Hs01_00021147 predicted 1408
11 SASI_Hs01_00021140 predicted 1571
12 SASI_Hs01_00021145 predicted 1415
13 SASI_Hs01_00021146 predicted 1579
14 SASI_Hs01_00021148 predicted 634
15 SASI_Hs01_00021149 predicted 1385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107902 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233405 predicted 971
2 SASI_Rn02_00233406 predicted 717
3 SASI_Rn02_00233407 predicted 1553
4 SASI_Rn02_00233408 predicted 1591
5 SASI_Rn02_00233409 predicted 503
6 SASI_Rn02_00233410 predicted 1761
7 SASI_Rn02_00233411 predicted 1605
8 SASI_Rn02_00233412 predicted 598
9 SASI_Rn02_00233413 predicted 1889
10 SASI_Rn02_00233414 predicted 1718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011441 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169571 predicted 2444
2 SASI_Mm01_00169572 predicted 1497
3 SASI_Mm02_00320682 predicted 1403
4 SASI_Mm01_00169574 predicted 2360
5 SASI_Mm02_00320683 predicted 2298
6 SASI_Mm01_00169575 predicted 2774
7 SASI_Mm01_00169576 predicted 2723
8 SASI_Mm01_00169578 predicted 2597
9 SASI_Mm02_00320684 predicted 1351
10 SASI_Mm02_00320685 predicted 2822
11 SASI_Mm01_00169570 predicted 2220
12 SASI_Mm01_00169573 predicted 1828
13 SASI_Mm01_00169577 predicted 2180
14 SASI_Mm01_00169579 predicted 2385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022454
SOX17 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 17
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022454.3-1940s21c1
Sequence:CCGGTAAATGCCTTTAAGGAGTATACTCGAGTATACTCCTTAAAGGCATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022454.3-1566s21c1
Sequence:CCGGAGGTGTGTTGGCATATAATTTCTCGAGAAATTATATGCCAACACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022454.3-1688s21c1
Sequence:CCGGCTATTTCCAAGTTCAAGTTAACTCGAGTTAACTTGAACTTGGAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022454.3-1748s21c1
Sequence:CCGGCTGAAAGTTTATTGATCAAAGCTCGAGCTTTGATCAATAAACTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022454.3-486s21c1
Sequence:CCGGCAACGCCGAGTTGAGCAAGATCTCGAGATCTTGCTCAACTCGGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022454.2-1299s1c1
Sequence:CCGGGTATCTGCACTTCGTGTGCAACTCGAGTTGCACACGAAGTGCAGATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022454.2-1282s1c1
Sequence:CCGGCGCACGGAATTTGAACAGTATCTCGAGATACTGTTCAAATTCCGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022454.2-1416s1c1
Sequence:CCGGCGCGGTATATTACTGCAACTACTCGAGTAGTTGCAGTAATATACCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022454.2-1417s1c1
Sequence:CCGGGCGGTATATTACTGCAACTATCTCGAGATAGTTGCAGTAATATACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022454.2-948s1c1
Sequence:CCGGCGGCACCTACAGCTACGCGCACTCGAGTGCGCGTAGCTGTAGGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022454
SOX17 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 17
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022454.3-1940s21c1
Sequence:CCGGTAAATGCCTTTAAGGAGTATACTCGAGTATACTCCTTAAAGGCATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022454.3-1566s21c1
Sequence:CCGGAGGTGTGTTGGCATATAATTTCTCGAGAAATTATATGCCAACACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022454.3-1688s21c1
Sequence:CCGGCTATTTCCAAGTTCAAGTTAACTCGAGTTAACTTGAACTTGGAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022454.3-1748s21c1
Sequence:CCGGCTGAAAGTTTATTGATCAAAGCTCGAGCTTTGATCAATAAACTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022454.3-486s21c1
Sequence:CCGGCAACGCCGAGTTGAGCAAGATCTCGAGATCTTGCTCAACTCGGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022454.2-1299s1c1
Sequence:CCGGGTATCTGCACTTCGTGTGCAACTCGAGTTGCACACGAAGTGCAGATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022454.2-1282s1c1
Sequence:CCGGCGCACGGAATTTGAACAGTATCTCGAGATACTGTTCAAATTCCGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022454.2-1416s1c1
Sequence:CCGGCGCGGTATATTACTGCAACTACTCGAGTAGTTGCAGTAATATACCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022454.2-1417s1c1
Sequence:CCGGGCGGTATATTACTGCAACTATCTCGAGATAGTTGCAGTAATATACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022454.2-948s1c1
Sequence:CCGGCGGCACCTACAGCTACGCGCACTCGAGTGCGCGTAGCTGTAGGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022454
SOX17 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 17
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022454.3-1940s21c1
Sequence:CCGGTAAATGCCTTTAAGGAGTATACTCGAGTATACTCCTTAAAGGCATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022454.3-1566s21c1
Sequence:CCGGAGGTGTGTTGGCATATAATTTCTCGAGAAATTATATGCCAACACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022454.3-1688s21c1
Sequence:CCGGCTATTTCCAAGTTCAAGTTAACTCGAGTTAACTTGAACTTGGAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022454.3-1748s21c1
Sequence:CCGGCTGAAAGTTTATTGATCAAAGCTCGAGCTTTGATCAATAAACTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022454.3-486s21c1
Sequence:CCGGCAACGCCGAGTTGAGCAAGATCTCGAGATCTTGCTCAACTCGGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022454.2-1299s1c1
Sequence:CCGGGTATCTGCACTTCGTGTGCAACTCGAGTTGCACACGAAGTGCAGATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022454.2-1282s1c1
Sequence:CCGGCGCACGGAATTTGAACAGTATCTCGAGATACTGTTCAAATTCCGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022454.2-1416s1c1
Sequence:CCGGCGCGGTATATTACTGCAACTACTCGAGTAGTTGCAGTAATATACCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022454.2-1417s1c1
Sequence:CCGGGCGGTATATTACTGCAACTATCTCGAGATAGTTGCAGTAATATACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022454.2-948s1c1
Sequence:CCGGCGGCACCTACAGCTACGCGCACTCGAGTGCGCGTAGCTGTAGGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011441
SOX17 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 17
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011441.4-1305s21c1
Sequence:CCGGTTTATGGTGTGGGCCAAAGACCTCGAGGTCTTTGGCCCACACCATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011441.4-2590s21c1
Sequence:CCGGTCCATTTCTTGAAAGTGTATTCTCGAGAATACACTTTCAAGAAATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011441.4-2433s21c1
Sequence:CCGGTAAGTTGCCTTGGCATATAATCTCGAGATTATATGCCAAGGCAACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011441.2-2203s1c1
Sequence:CCGGCTTTGTGTATAAGCCCGAGATCTCGAGATCTCGGGCTTATACACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011441.2-1375s1c1
Sequence:CCGGGCTAAGCAAGATGCTAGGCAACTCGAGTTGCCTAGCATCTTGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011441.2-2311s1c1
Sequence:CCGGAGCGGTCTACTATTGCAACTACTCGAGTAGTTGCAATAGTAGACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011441.2-2177s1c1
Sequence:CCGGCGCACGGAATTCGAACAGTATCTCGAGATACTGTTCGAATTCCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011441
SOX17 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 17
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011441.4-1305s21c1
Sequence:CCGGTTTATGGTGTGGGCCAAAGACCTCGAGGTCTTTGGCCCACACCATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011441.4-2590s21c1
Sequence:CCGGTCCATTTCTTGAAAGTGTATTCTCGAGAATACACTTTCAAGAAATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011441.4-2433s21c1
Sequence:CCGGTAAGTTGCCTTGGCATATAATCTCGAGATTATATGCCAAGGCAACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011441.2-2203s1c1
Sequence:CCGGCTTTGTGTATAAGCCCGAGATCTCGAGATCTCGGGCTTATACACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011441.2-1375s1c1
Sequence:CCGGGCTAAGCAAGATGCTAGGCAACTCGAGTTGCCTAGCATCTTGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011441.2-2311s1c1
Sequence:CCGGAGCGGTCTACTATTGCAACTACTCGAGTAGTTGCAATAGTAGACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011441.2-2177s1c1
Sequence:CCGGCGCACGGAATTCGAACAGTATCTCGAGATACTGTTCGAATTCCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011441
SOX17 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 17
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011441.4-1305s21c1
Sequence:CCGGTTTATGGTGTGGGCCAAAGACCTCGAGGTCTTTGGCCCACACCATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011441.4-2590s21c1
Sequence:CCGGTCCATTTCTTGAAAGTGTATTCTCGAGAATACACTTTCAAGAAATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011441.4-2433s21c1
Sequence:CCGGTAAGTTGCCTTGGCATATAATCTCGAGATTATATGCCAAGGCAACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011441.2-2203s1c1
Sequence:CCGGCTTTGTGTATAAGCCCGAGATCTCGAGATCTCGGGCTTATACACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011441.2-1375s1c1
Sequence:CCGGGCTAAGCAAGATGCTAGGCAACTCGAGTTGCCTAGCATCTTGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011441.2-2311s1c1
Sequence:CCGGAGCGGTCTACTATTGCAACTACTCGAGTAGTTGCAATAGTAGACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011441.2-2177s1c1
Sequence:CCGGCGCACGGAATTCGAACAGTATCTCGAGATACTGTTCGAATTCCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks