EMAIL THIS PAGE TO A FRIEND

SOX18

SRY (sex determining region Y)-box 18

Synonyms: HLTS
UniProtKB ID: P35713, Q0VGA9, Q9NPH8
Gene ID:
Human(54345) Summary: This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. This protein plays a role in hair, blood vessel, and lymphatic vessel development. Mutations in this gene have been associated with recessive and dominant forms of hypotrichosis-lymphedema-telangiectasia. [provided by RefSeq, Jul 2008]
Mouse(20672) SRY-box containing gene 18
Rat(311723) SRY (sex determining region Y)-box 18
Zebrafish(797246) SRY-box containing gene 18
dog(485984) SRY (sex determining region Y)-box 18
chicken(374200) SRY (sex determining region Y)-box 18
naked mole-rat(101705099) SRY (sex determining region Y)-box 18
domestic guinea pig(100727175) SRY (sex determining region Y)-box 18
cow(519439) SRY (sex determining region Y)-box 18
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018419 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018419 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018419 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009236 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009236 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009236 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU062251 MISSION® esiRNA esiRNA targeting mouse Sox18 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018419 Rosetta Predictions human pricing
NM_001024781 Rosetta Predictions rat pricing
NM_009236 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197780 predicted 1330
2 SASI_Hs01_00197785 predicted 531
3 SASI_Hs01_00197786 predicted 506
4 SASI_Hs01_00197787 predicted 522
5 SASI_Hs02_00351929 predicted 642
6 SASI_Hs02_00351930 predicted 568
7 SASI_Hs02_00351931 predicted 1336
8 SASI_Hs02_00351932 predicted 579
9 SASI_Hs02_00351933 predicted 1401
10 SASI_Hs01_00197778 predicted 1352
11 SASI_Hs01_00197779 predicted 1351
12 SASI_Hs01_00197781 predicted 1359
13 SASI_Hs01_00197782 predicted 1352
14 SASI_Hs01_00197783 predicted 1357
15 SASI_Hs01_00197784 predicted 1277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067110 predicted 1034
2 SASI_Rn01_00067111 predicted 1040
3 SASI_Rn01_00067113 predicted 1055
4 SASI_Rn01_00067114 predicted 1233
5 SASI_Rn01_00067115 predicted 1020
6 SASI_Rn01_00067116 predicted 1084
7 SASI_Rn01_00067117 predicted 1305
8 SASI_Rn01_00067119 predicted 282
9 SASI_Rn02_00202674 predicted 1110
10 SASI_Rn02_00202675 predicted 1143
11 SASI_Rn01_00067112 predicted 365
12 SASI_Rn01_00067118 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009236 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315698 predicted 1052
2 SASI_Mm02_00315699 predicted 1047
3 SASI_Mm02_00315700 predicted 1099
4 SASI_Mm02_00315701 predicted 1320
5 SASI_Mm01_00036737 predicted 342
6 SASI_Mm02_00315702 predicted 1032
7 SASI_Mm02_00315703 predicted 1211
8 SASI_Mm02_00315704 predicted 1303
9 SASI_Mm02_00315705 predicted 1064
10 SASI_Mm02_00315706 predicted 1066
11 SASI_Mm01_00036738 predicted 674
12 SASI_Mm01_00036739 predicted 304
13 SASI_Mm01_00036740 predicted 261
14 SASI_Mm01_00036741 predicted 398
15 SASI_Mm01_00036742 predicted 493
16 SASI_Mm01_00036743 predicted 426
17 SASI_Mm01_00036744 predicted 525
18 SASI_Mm01_00036745 predicted 371
19 SASI_Mm01_00036746 predicted 397
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018419
SOX18 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 18
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018419.2-1079s1c1
Sequence:CCGGCCTCACCGAGTTCGACCAGTACTCGAGTACTGGTCGAACTCGGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018419.2-941s1c1
Sequence:CCGGGCCGCTCGCTGGCCTGTACTACTCGAGTAGTACAGGCCAGCGAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018419.2-470s1c1
Sequence:CCGGCAAAGCGTGGAAGGAGCTGAACTCGAGTTCAGCTCCTTCCACGCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018419.2-1234s1c1
Sequence:CCGGCGGTCTATTACAGCGCGTGCACTCGAGTGCACGCGCTGTAATAGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018419.2-507s1c1
Sequence:CCGGCCCTTCGTGGAGGAAGCCGAACTCGAGTTCGGCTTCCTCCACGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018419.2-1344s21c1
Sequence:CCGGTGCTCTCTCATACGCGTGTATCTCGAGATACACGCGTATGAGAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018419.2-1357s21c1
Sequence:CCGGGCGTGTATGTTTGGTTCCATGCTCGAGCATGGAACCAAACATACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018419.2-443s21c1
Sequence:CCGGCAACGCGGTGCTCAGCAAGATCTCGAGATCTTGCTGAGCACCGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018419.2-1548s21c1
Sequence:CCGGAGAGTTGCCAGGGTTACATTTCTCGAGAAATGTAACCCTGGCAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018419
SOX18 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 18
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018419.2-1079s1c1
Sequence:CCGGCCTCACCGAGTTCGACCAGTACTCGAGTACTGGTCGAACTCGGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018419.2-941s1c1
Sequence:CCGGGCCGCTCGCTGGCCTGTACTACTCGAGTAGTACAGGCCAGCGAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018419.2-470s1c1
Sequence:CCGGCAAAGCGTGGAAGGAGCTGAACTCGAGTTCAGCTCCTTCCACGCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018419.2-1234s1c1
Sequence:CCGGCGGTCTATTACAGCGCGTGCACTCGAGTGCACGCGCTGTAATAGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018419.2-507s1c1
Sequence:CCGGCCCTTCGTGGAGGAAGCCGAACTCGAGTTCGGCTTCCTCCACGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018419.2-1344s21c1
Sequence:CCGGTGCTCTCTCATACGCGTGTATCTCGAGATACACGCGTATGAGAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018419.2-1357s21c1
Sequence:CCGGGCGTGTATGTTTGGTTCCATGCTCGAGCATGGAACCAAACATACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018419.2-443s21c1
Sequence:CCGGCAACGCGGTGCTCAGCAAGATCTCGAGATCTTGCTGAGCACCGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018419.2-1548s21c1
Sequence:CCGGAGAGTTGCCAGGGTTACATTTCTCGAGAAATGTAACCCTGGCAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018419
SOX18 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 18
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018419.2-1079s1c1
Sequence:CCGGCCTCACCGAGTTCGACCAGTACTCGAGTACTGGTCGAACTCGGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018419.2-941s1c1
Sequence:CCGGGCCGCTCGCTGGCCTGTACTACTCGAGTAGTACAGGCCAGCGAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018419.2-470s1c1
Sequence:CCGGCAAAGCGTGGAAGGAGCTGAACTCGAGTTCAGCTCCTTCCACGCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018419.2-1234s1c1
Sequence:CCGGCGGTCTATTACAGCGCGTGCACTCGAGTGCACGCGCTGTAATAGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018419.2-507s1c1
Sequence:CCGGCCCTTCGTGGAGGAAGCCGAACTCGAGTTCGGCTTCCTCCACGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018419.2-1344s21c1
Sequence:CCGGTGCTCTCTCATACGCGTGTATCTCGAGATACACGCGTATGAGAGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018419.2-1357s21c1
Sequence:CCGGGCGTGTATGTTTGGTTCCATGCTCGAGCATGGAACCAAACATACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018419.2-443s21c1
Sequence:CCGGCAACGCGGTGCTCAGCAAGATCTCGAGATCTTGCTGAGCACCGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018419.2-1548s21c1
Sequence:CCGGAGAGTTGCCAGGGTTACATTTCTCGAGAAATGTAACCCTGGCAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009236
SOX18 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 18
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009236.1-1290s1c1
Sequence:CCGGCGCATATGTATGTTAGGGTATCTCGAGATACCCTAACATACATATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009236.1-1036s1c1
Sequence:CCGGCCTCACCGAATTTGACCAGTACTCGAGTACTGGTCAAATTCGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009236.1-1041s1c1
Sequence:CCGGCCGAATTTGACCAGTATCTCACTCGAGTGAGATACTGGTCAAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009236.1-508s1c1
Sequence:CCGGGCGCGACCATCCCAACTACAACTCGAGTTGTAGTTGGGATGGTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009236.1-1191s1c1
Sequence:CCGGCGGTCTATTACAGTGCTTGCACTCGAGTGCAAGCACTGTAATAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009236.2-434s21c1
Sequence:CCGGCAACGCAGTACTGAGCAAGATCTCGAGATCTTGCTCAGTACTGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009236.2-1361s21c1
Sequence:CCGGGTGGCCTAAAGATGCCATTTCCTCGAGGAAATGGCATCTTTAGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009236.2-297s21c1
Sequence:CCGGGAATCAGGGCGCTATGGCTTTCTCGAGAAAGCCATAGCGCCCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009236.2-1178s21c1
Sequence:CCGGAGAAGAGAGCAGCCTCATTTCCTCGAGGAAATGAGGCTGCTCTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009236
SOX18 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 18
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009236.1-1290s1c1
Sequence:CCGGCGCATATGTATGTTAGGGTATCTCGAGATACCCTAACATACATATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009236.1-1036s1c1
Sequence:CCGGCCTCACCGAATTTGACCAGTACTCGAGTACTGGTCAAATTCGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009236.1-1041s1c1
Sequence:CCGGCCGAATTTGACCAGTATCTCACTCGAGTGAGATACTGGTCAAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009236.1-508s1c1
Sequence:CCGGGCGCGACCATCCCAACTACAACTCGAGTTGTAGTTGGGATGGTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009236.1-1191s1c1
Sequence:CCGGCGGTCTATTACAGTGCTTGCACTCGAGTGCAAGCACTGTAATAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009236.2-434s21c1
Sequence:CCGGCAACGCAGTACTGAGCAAGATCTCGAGATCTTGCTCAGTACTGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009236.2-1361s21c1
Sequence:CCGGGTGGCCTAAAGATGCCATTTCCTCGAGGAAATGGCATCTTTAGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009236.2-297s21c1
Sequence:CCGGGAATCAGGGCGCTATGGCTTTCTCGAGAAAGCCATAGCGCCCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009236.2-1178s21c1
Sequence:CCGGAGAAGAGAGCAGCCTCATTTCCTCGAGGAAATGAGGCTGCTCTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009236
SOX18 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 18
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009236.1-1290s1c1
Sequence:CCGGCGCATATGTATGTTAGGGTATCTCGAGATACCCTAACATACATATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009236.1-1036s1c1
Sequence:CCGGCCTCACCGAATTTGACCAGTACTCGAGTACTGGTCAAATTCGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009236.1-1041s1c1
Sequence:CCGGCCGAATTTGACCAGTATCTCACTCGAGTGAGATACTGGTCAAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009236.1-508s1c1
Sequence:CCGGGCGCGACCATCCCAACTACAACTCGAGTTGTAGTTGGGATGGTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009236.1-1191s1c1
Sequence:CCGGCGGTCTATTACAGTGCTTGCACTCGAGTGCAAGCACTGTAATAGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009236.2-434s21c1
Sequence:CCGGCAACGCAGTACTGAGCAAGATCTCGAGATCTTGCTCAGTACTGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009236.2-1361s21c1
Sequence:CCGGGTGGCCTAAAGATGCCATTTCCTCGAGGAAATGGCATCTTTAGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009236.2-297s21c1
Sequence:CCGGGAATCAGGGCGCTATGGCTTTCTCGAGAAAGCCATAGCGCCCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009236.2-1178s21c1
Sequence:CCGGAGAAGAGAGCAGCCTCATTTCCTCGAGGAAATGAGGCTGCTCTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks