EMAIL THIS PAGE TO A FRIEND

SOX1

SRY (sex determining region Y)-box 1

UniProtKB ID: O00570, Q5W0Q1
Gene ID:
Human(6656) Summary: This intronless gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. In mice, a similar protein regulates the gamma-crystallin genes and is essential for lens development. [provided by RefSeq, Jul 2008]
Mouse(20664) SRY-box containing gene 1
chicken(374240) SRY (sex determining region Y)-box 1
dog(607464) SRY (sex determining region Y)-box 1
cow(618135) SRY (sex determining region Y)-box 1
domestic guinea pig(101787499) SRY (sex determining region Y)-box 1
naked mole-rat(101713031) SRY (sex determining region Y)-box 1
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108717 Anti-SOX1 affinity isolated antibody dog, zebrafish, rat, bovine, human, mouse, guinea pig
western blot pricing
SAB1100735 Anti-SOX1 (11-25) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1100736 Anti-SOX1 (256-270) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1300687 Anti-SOX1 (center) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2102263 Anti-SOX1 antibody produced in rabbit affinity isolated antibody guinea pig, canine, rabbit, human, zebrafish, mouse
western blot pricing
SAB2102982 Anti-SOX1 antibody produced in rabbit affinity isolated antibody canine, mouse, human, rabbit, zebrafish
western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0314 AQUA Peptide RPFIDEA[K] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, pig, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009233 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009233 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009233 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005986 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005986 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005986 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005986 Rosetta Predictions human pricing
NM_009233 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005986 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070642 predicted 1601
2 SASI_Hs01_00070643 predicted 3134
3 SASI_Hs01_00070644 predicted 2237
4 SASI_Hs01_00070645 predicted 4013
5 SASI_Hs02_00340677 predicted 4028
6 SASI_Hs01_00070646 predicted 3578
7 SASI_Hs01_00070649 predicted 1783
8 SASI_Hs01_00070650 predicted 2483
9 SASI_Hs01_00070651 predicted 3714
10 SASI_Hs02_00340678 predicted 2035
11 SASI_Hs01_00070647 predicted 4036
12 SASI_Hs01_00070648 predicted 2499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009233 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315688 predicted 2442
2 SASI_Mm02_00315689 predicted 2276
3 SASI_Mm02_00315690 predicted 2218
4 SASI_Mm02_00315691 predicted 2456
5 SASI_Mm02_00315692 predicted 2207
6 SASI_Mm02_00315693 predicted 2512
7 SASI_Mm02_00315694 predicted 2458
8 SASI_Mm02_00315695 predicted 2434
9 SASI_Mm01_00156538 predicted 1376
10 SASI_Mm01_00156539 predicted 1588
11 SASI_Mm01_00156536 predicted 341
12 SASI_Mm01_00156537 predicted 776
13 SASI_Mm01_00156540 predicted 548
14 SASI_Mm01_00156541 predicted 551
15 SASI_Mm01_00156542 predicted 267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009233
SOX1 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009233.1-545s1c1
Sequence:CCGGCGCATGTCAACGGCTGGGCTACTCGAGTAGCCCAGCCGTTGACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009233.1-132s1c1
Sequence:CCGGCAAGGCCAACCAGGATCGGGTCTCGAGACCCGATCCTGGTTGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009233.1-988s1c1
Sequence:CCGGGCTCACTCACGGGCACCGTGTCTCGAGACACGGTGCCCGTGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009233.1-777s1c1
Sequence:CCGGCTCCAACTCTCAGGGCTACATCTCGAGATGTAGCCCTGAGAGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009233.3-2461s21c1
Sequence:CCGGGTAAGGCAGATCCAAACATTTCTCGAGAAATGTTTGGATCTGCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009233.3-2220s21c1
Sequence:CCGGGGCCTCTTAGACTGAACTTTGCTCGAGCAAAGTTCAGTCTAAGAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009233.3-1180s21c1
Sequence:CCGGAGGAACACCCGGATTACAAGTCTCGAGACTTGTAATCCGGGTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009233.3-1865s21c1
Sequence:CCGGCGAGATGATCAGCATGTACCTCTCGAGAGGTACATGCTGATCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009233
SOX1 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009233.1-545s1c1
Sequence:CCGGCGCATGTCAACGGCTGGGCTACTCGAGTAGCCCAGCCGTTGACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009233.1-132s1c1
Sequence:CCGGCAAGGCCAACCAGGATCGGGTCTCGAGACCCGATCCTGGTTGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009233.1-988s1c1
Sequence:CCGGGCTCACTCACGGGCACCGTGTCTCGAGACACGGTGCCCGTGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009233.1-777s1c1
Sequence:CCGGCTCCAACTCTCAGGGCTACATCTCGAGATGTAGCCCTGAGAGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009233.3-2461s21c1
Sequence:CCGGGTAAGGCAGATCCAAACATTTCTCGAGAAATGTTTGGATCTGCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009233.3-2220s21c1
Sequence:CCGGGGCCTCTTAGACTGAACTTTGCTCGAGCAAAGTTCAGTCTAAGAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009233.3-1180s21c1
Sequence:CCGGAGGAACACCCGGATTACAAGTCTCGAGACTTGTAATCCGGGTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009233.3-1865s21c1
Sequence:CCGGCGAGATGATCAGCATGTACCTCTCGAGAGGTACATGCTGATCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009233
SOX1 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009233.1-545s1c1
Sequence:CCGGCGCATGTCAACGGCTGGGCTACTCGAGTAGCCCAGCCGTTGACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009233.1-132s1c1
Sequence:CCGGCAAGGCCAACCAGGATCGGGTCTCGAGACCCGATCCTGGTTGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009233.1-988s1c1
Sequence:CCGGGCTCACTCACGGGCACCGTGTCTCGAGACACGGTGCCCGTGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009233.1-777s1c1
Sequence:CCGGCTCCAACTCTCAGGGCTACATCTCGAGATGTAGCCCTGAGAGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009233.3-2461s21c1
Sequence:CCGGGTAAGGCAGATCCAAACATTTCTCGAGAAATGTTTGGATCTGCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009233.3-2220s21c1
Sequence:CCGGGGCCTCTTAGACTGAACTTTGCTCGAGCAAAGTTCAGTCTAAGAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009233.3-1180s21c1
Sequence:CCGGAGGAACACCCGGATTACAAGTCTCGAGACTTGTAATCCGGGTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009233.3-1865s21c1
Sequence:CCGGCGAGATGATCAGCATGTACCTCTCGAGAGGTACATGCTGATCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005986
SOX1 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005986.2-834s1c1
Sequence:CCGGCATCTCCAACTCGCAGGGCTACTCGAGTAGCCCTGCGAGTTGGAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005986.2-444s1c1
Sequence:CCGGGCTGCTCAAGAAGGACAAGTACTCGAGTACTTGTCCTTCTTGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005986.2-1797s1c1
Sequence:CCGGGCGGAGTTATATTCTGGGTTTCTCGAGAAACCCAGAATATAACTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005986.2-196s1c1
Sequence:CCGGGCCAACCAGGACCGGGTCAAACTCGAGTTTGACCCGGTCCTGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005986.2-998s1c1
Sequence:CCGGCGCTGGGCTCTCTGGTGAAGTCTCGAGACTTCACCAGAGAGCCCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005986.2-1336s21c1
Sequence:CCGGCGTTCCCACATTCTTGTCAAACTCGAGTTTGACAAGAATGTGGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005986.2-1223s21c1
Sequence:CCGGTGACGCACATCTAGCGCCTTCCTCGAGGAAGGCGCTAGATGTGCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005986
SOX1 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005986.2-834s1c1
Sequence:CCGGCATCTCCAACTCGCAGGGCTACTCGAGTAGCCCTGCGAGTTGGAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005986.2-444s1c1
Sequence:CCGGGCTGCTCAAGAAGGACAAGTACTCGAGTACTTGTCCTTCTTGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005986.2-1797s1c1
Sequence:CCGGGCGGAGTTATATTCTGGGTTTCTCGAGAAACCCAGAATATAACTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005986.2-196s1c1
Sequence:CCGGGCCAACCAGGACCGGGTCAAACTCGAGTTTGACCCGGTCCTGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005986.2-998s1c1
Sequence:CCGGCGCTGGGCTCTCTGGTGAAGTCTCGAGACTTCACCAGAGAGCCCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005986.2-1336s21c1
Sequence:CCGGCGTTCCCACATTCTTGTCAAACTCGAGTTTGACAAGAATGTGGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005986.2-1223s21c1
Sequence:CCGGTGACGCACATCTAGCGCCTTCCTCGAGGAAGGCGCTAGATGTGCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005986
SOX1 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005986.2-834s1c1
Sequence:CCGGCATCTCCAACTCGCAGGGCTACTCGAGTAGCCCTGCGAGTTGGAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005986.2-444s1c1
Sequence:CCGGGCTGCTCAAGAAGGACAAGTACTCGAGTACTTGTCCTTCTTGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005986.2-1797s1c1
Sequence:CCGGGCGGAGTTATATTCTGGGTTTCTCGAGAAACCCAGAATATAACTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005986.2-196s1c1
Sequence:CCGGGCCAACCAGGACCGGGTCAAACTCGAGTTTGACCCGGTCCTGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005986.2-998s1c1
Sequence:CCGGCGCTGGGCTCTCTGGTGAAGTCTCGAGACTTCACCAGAGAGCCCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005986.2-1336s21c1
Sequence:CCGGCGTTCCCACATTCTTGTCAAACTCGAGTTTGACAAGAATGTGGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005986.2-1223s21c1
Sequence:CCGGTGACGCACATCTAGCGCCTTCCTCGAGGAAGGCGCTAGATGTGCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks