EMAIL THIS PAGE TO A FRIEND

SOX21

SRY (sex determining region Y)-box 21

Synonyms: SOX25
UniProtKB ID: Q9Y651, P35715, Q15504, Q5TBS1
Gene ID:
Human(11166) Summary: SRY-related HMG-box (SOX) genes encode a family of DNA-binding proteins containing a 79-amino acid HMG (high mobility group) domain that shares at least 50% sequence identity with the DNA-binding HMG box of the SRY protein (MIM 480000). SOX proteins are divided into 6 subgroups based on sequence similarity within and outside of the HMG domain. For additional background information on SOX genes, see SOX1 (MIM 602148).[supplied by OMIM, Apr 2004]
Mouse(223227) SRY-box containing gene 21
Rat(306168) SRY (sex determining region Y)-box 21
dog(100686255) SRY (sex determining region Y)-box 21
naked mole-rat(101703985) SRY (sex determining region Y)-box 21
cow(614121) SRY (sex determining region Y)-box 21
131 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0314 AQUA Peptide RPFIDEA[K] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, pig, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007084 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007084 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007084 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145464 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145464 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145464 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_177753 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177753 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177753 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU015901 MISSION® esiRNA esiRNA targeting mouse Sox21 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007084 Rosetta Predictions human pricing
XM_001078360 Rosetta Predictions rat pricing
XM_224521 Rosetta Predictions rat pricing
NM_145464 Rosetta Predictions mouse pricing
NM_177753 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007084 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112984 predicted 1012
2 SASI_Hs01_00112985 predicted 947
3 SASI_Hs01_00112986 predicted 939
4 SASI_Hs01_00112988 predicted 265
5 SASI_Hs01_00112989 predicted 783
6 SASI_Hs01_00112990 predicted 1202
7 SASI_Hs01_00112991 predicted 624
8 SASI_Hs01_00112992 predicted 1171
9 SASI_Hs01_00112993 predicted 1174
10 SASI_Hs02_00342922 predicted 1258
11 SASI_Hs01_00112987 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078360 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360524 predicted 382
2 SASI_Rn02_00360525 predicted 2371
3 SASI_Rn02_00360526 predicted 785
4 SASI_Rn02_00360527 predicted 1043
5 SASI_Rn02_00360528 predicted 2229
6 SASI_Rn02_00360529 predicted 2159
7 SASI_Rn02_00360530 predicted 328
8 SASI_Rn02_00360531 predicted 2193
9 SASI_Rn02_00360532 predicted 1459
10 SASI_Rn02_00360533 predicted 2412
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224521 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382058 predicted 381
2 SASI_Rn02_00382059 predicted 695
3 SASI_Rn02_00382060 predicted 951
4 SASI_Rn02_00382061 predicted 837
5 SASI_Rn02_00382062 predicted 320
6 SASI_Rn02_00382063 predicted 325
7 SASI_Rn02_00382064 predicted 1373
8 SASI_Rn02_00382065 predicted 858
9 SASI_Rn02_00382066 predicted 816
10 SASI_Rn02_00382067 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178635 predicted 1476
2 SASI_Mm01_00178636 predicted 1130
3 SASI_Mm01_00178637 predicted 1131
4 SASI_Mm01_00178638 predicted 1452
5 SASI_Mm01_00178639 predicted 1373
6 SASI_Mm01_00178640 predicted 1259
7 SASI_Mm01_00178641 predicted 1473
8 SASI_Mm01_00178642 predicted 1187
9 SASI_Mm01_00178643 predicted 1286
10 SASI_Mm01_00178644 predicted 1473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026535 predicted 1527
2 SASI_Mm01_00026536 predicted 1536
3 SASI_Mm01_00026537 predicted 1312
4 SASI_Mm01_00026538 predicted 1180
5 SASI_Mm01_00026539 predicted 1499
6 SASI_Mm01_00026540 predicted 1310
7 SASI_Mm01_00026541 predicted 1238
8 SASI_Mm01_00026542 predicted 1341
9 SASI_Mm01_00026543 predicted 1519
10 SASI_Mm01_00026544 predicted 408
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007084
SOX21 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 21
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007084.2-1475s1c1
Sequence:CCGGGCCTCCCTGTTTGTACTATTTCTCGAGAAATAGTACAAACAGGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007084.2-656s1c1
Sequence:CCGGGTACGCGTCGTCGCTGGGCTACTCGAGTAGCCCAGCGACGACGCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007084.2-784s1c1
Sequence:CCGGGCTACATGATCCCGTGCAACTCTCGAGAGTTGCACGGGATCATGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007084.2-347s1c1
Sequence:CCGGCAAGAAGGACAAGTTCGCCTTCTCGAGAAGGCGAACTTGTCCTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007084.2-621s21c1
Sequence:CCGGATGGCAGAGATCTCGTCGTCCCTCGAGGGACGACGAGATCTCTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007084.2-1235s21c1
Sequence:CCGGACGGAGGTGGAGGAGTAACTTCTCGAGAAGTTACTCCTCCACCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007084
SOX21 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 21
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007084.2-1475s1c1
Sequence:CCGGGCCTCCCTGTTTGTACTATTTCTCGAGAAATAGTACAAACAGGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007084.2-656s1c1
Sequence:CCGGGTACGCGTCGTCGCTGGGCTACTCGAGTAGCCCAGCGACGACGCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007084.2-784s1c1
Sequence:CCGGGCTACATGATCCCGTGCAACTCTCGAGAGTTGCACGGGATCATGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007084.2-347s1c1
Sequence:CCGGCAAGAAGGACAAGTTCGCCTTCTCGAGAAGGCGAACTTGTCCTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007084.2-621s21c1
Sequence:CCGGATGGCAGAGATCTCGTCGTCCCTCGAGGGACGACGAGATCTCTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007084.2-1235s21c1
Sequence:CCGGACGGAGGTGGAGGAGTAACTTCTCGAGAAGTTACTCCTCCACCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007084
SOX21 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 21
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007084.2-1475s1c1
Sequence:CCGGGCCTCCCTGTTTGTACTATTTCTCGAGAAATAGTACAAACAGGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007084.2-656s1c1
Sequence:CCGGGTACGCGTCGTCGCTGGGCTACTCGAGTAGCCCAGCGACGACGCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007084.2-784s1c1
Sequence:CCGGGCTACATGATCCCGTGCAACTCTCGAGAGTTGCACGGGATCATGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007084.2-347s1c1
Sequence:CCGGCAAGAAGGACAAGTTCGCCTTCTCGAGAAGGCGAACTTGTCCTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007084.2-621s21c1
Sequence:CCGGATGGCAGAGATCTCGTCGTCCCTCGAGGGACGACGAGATCTCTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007084.2-1235s21c1
Sequence:CCGGACGGAGGTGGAGGAGTAACTTCTCGAGAAGTTACTCCTCCACCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145464
SOX21 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 21
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145464.1-1132s1c1
Sequence:CCGGCCGGTTTGTATGTACATAGATCTCGAGATCTATGTACATACAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145464.1-910s1c1
Sequence:CCGGCGGCTACATGATCCCGTGCAACTCGAGTTGCACGGGATCATGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145464.1-355s1c1
Sequence:CCGGGCTGCTCACCGAGTCGGAGAACTCGAGTTCTCCGACTCGGTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145464.1-410s1c1
Sequence:CCGGGCAATGCACATGAAGGAGCATCTCGAGATGCTCCTTCATGTGCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145464.1-593s1c1
Sequence:CCGGCCCGAGTCTCTGCTCGCGAACCTCGAGGTTCGCGAGCAGAGACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145464
SOX21 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 21
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145464.1-1132s1c1
Sequence:CCGGCCGGTTTGTATGTACATAGATCTCGAGATCTATGTACATACAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145464.1-910s1c1
Sequence:CCGGCGGCTACATGATCCCGTGCAACTCGAGTTGCACGGGATCATGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145464.1-355s1c1
Sequence:CCGGGCTGCTCACCGAGTCGGAGAACTCGAGTTCTCCGACTCGGTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145464.1-410s1c1
Sequence:CCGGGCAATGCACATGAAGGAGCATCTCGAGATGCTCCTTCATGTGCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145464.1-593s1c1
Sequence:CCGGCCCGAGTCTCTGCTCGCGAACCTCGAGGTTCGCGAGCAGAGACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145464
SOX21 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 21
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145464.1-1132s1c1
Sequence:CCGGCCGGTTTGTATGTACATAGATCTCGAGATCTATGTACATACAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145464.1-910s1c1
Sequence:CCGGCGGCTACATGATCCCGTGCAACTCGAGTTGCACGGGATCATGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145464.1-355s1c1
Sequence:CCGGGCTGCTCACCGAGTCGGAGAACTCGAGTTCTCCGACTCGGTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145464.1-410s1c1
Sequence:CCGGGCAATGCACATGAAGGAGCATCTCGAGATGCTCCTTCATGTGCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145464.1-593s1c1
Sequence:CCGGCCCGAGTCTCTGCTCGCGAACCTCGAGGTTCGCGAGCAGAGACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177753
SOX21 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 21
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177753.3-1604s21c1
Sequence:CCGGAGGAGCATCCCGACTACAAGTCTCGAGACTTGTAGTCGGGATGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177753.3-2660s21c1
Sequence:CCGGTTCTGATGTTCGGTCTGAAATCTCGAGATTTCAGACCGAACATCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177753.3-2697s21c1
Sequence:CCGGAGCCGGTGACTCGTGTCTTTACTCGAGTAAAGACACGAGTCACCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177753.3-2462s21c1
Sequence:CCGGTTAAAGGAGAGCGGTTGTTAGCTCGAGCTAACAACCGCTCTCCTTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177753.3-1928s21c1
Sequence:CCGGAGATGGCAGAGATCTCGTCGTCTCGAGACGACGAGATCTCTGCCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177753
SOX21 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 21
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177753.3-1604s21c1
Sequence:CCGGAGGAGCATCCCGACTACAAGTCTCGAGACTTGTAGTCGGGATGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177753.3-2660s21c1
Sequence:CCGGTTCTGATGTTCGGTCTGAAATCTCGAGATTTCAGACCGAACATCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177753.3-2697s21c1
Sequence:CCGGAGCCGGTGACTCGTGTCTTTACTCGAGTAAAGACACGAGTCACCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177753.3-2462s21c1
Sequence:CCGGTTAAAGGAGAGCGGTTGTTAGCTCGAGCTAACAACCGCTCTCCTTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177753.3-1928s21c1
Sequence:CCGGAGATGGCAGAGATCTCGTCGTCTCGAGACGACGAGATCTCTGCCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177753
SOX21 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 21
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177753.3-1604s21c1
Sequence:CCGGAGGAGCATCCCGACTACAAGTCTCGAGACTTGTAGTCGGGATGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177753.3-2660s21c1
Sequence:CCGGTTCTGATGTTCGGTCTGAAATCTCGAGATTTCAGACCGAACATCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177753.3-2697s21c1
Sequence:CCGGAGCCGGTGACTCGTGTCTTTACTCGAGTAAAGACACGAGTCACCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177753.3-2462s21c1
Sequence:CCGGTTAAAGGAGAGCGGTTGTTAGCTCGAGCTAACAACCGCTCTCCTTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177753.3-1928s21c1
Sequence:CCGGAGATGGCAGAGATCTCGTCGTCTCGAGACGACGAGATCTCTGCCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks