EMAIL THIS PAGE TO A FRIEND

SOX2

SRY (sex determining region Y)-box 2

Synonyms: ANOP3 MCOPS3
UniProtKB ID: P48431, Q14537
Gene ID:
Human(6657) Summary: This intronless gene encodes a member of the SRY-related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The product of this gene is required for stem-cell maintenance in the central nervous system, and also regulates gene expression in the stomach. Mutations in this gene have been associated with optic nerve hypoplasia and with syndromic microphthalmia, a severe form of structural eye malformation. This gene lies within an intron of another gene called SOX2 overlapping transcript (SOX2OT). [provided by RefSeq, Jul 2008]
Mouse(20674) SRY-box containing gene 2
Rat(499593) SRY (sex determining region Y)-box 2
Zebrafish(378723) SRY-box containing gene 2
Horse(100146979) SRY (sex determining region Y)-box 2
domestic cat(100379629) SRY (sex determining region Y)-box 2
dog(488092) SRY (sex determining region Y)-box 2
chicken(396105) SRY (sex determining region Y)-box 2
cow(784383) SRY (sex determining region Y)-box 2
Goat(100861576) SRY (sex determining region Y)-box 2
sheep(101110563) SRY (sex determining region Y)-box 2
domestic guinea pig(100714747) SRY (sex determining region Y)-box 2
naked mole-rat(101723266) SRY (sex determining region Y)-box 2
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500176 Anti-SOX-2 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP76, affinity isolated antibody human (tested)
immunohistochemistry, western blot pricing
SAB2701800 Anti-sox2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
S9072 Anti-SOX2 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse, rat
flow cytometry, immunohistochemistry, western blot pricing
AV38232 Anti-SOX2 antibody produced in rabbit IgG fraction of antiserum zebrafish, canine, mouse, human, rat
western blot pricing
SAB3500363 Anti-SOX2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
SAB2104660 Anti-SOX2 antibody produced in rabbit affinity isolated antibody human, rabbit, sheep, goat, rat, canine, pig, zebrafish, bovine, mouse, guinea pig, horse
western blot pricing
SAB4300669 Anti-SOX2 antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
SAB2701973 Anti-SOX2 antibody produced in rabbit mouse, human
immunocytochemistry, immunofluorescence, western blot pricing
SAB2701974 Anti-SOX2 antibody produced in rabbit mouse, human
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
HPA045725 Anti-SOX2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB2103958 Anti-SOX2, (N-terminal) antibody produced in rabbit affinity isolated antibody horse, sheep, canine, mouse, pig, rat, human, goat, bovine, rabbit
western blot pricing
S1451 Monoclonal Anti-Sox2 antibody produced in mouse ~1.0 mg/mL, clone SOX2-6, purified immunoglobulin, buffered aqueous solution mouse, human
western blot pricing
SAB5300177 Monoclonal Anti-SOX2 antibody produced in mouse clone 10F10, ascites fluid human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5300369 Monoclonal Anti-SOX2 antibody produced in mouse clone 10F10C9, ascites fluid human
ELISA, western blot pricing
AMAB91307 Monoclonal Anti-SOX2 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL4716, purified immunoglobulin New human, mouse
immunofluorescence, immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1713 Human SOX2 ELISA for serum, plasma and cell culture supernatants human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0314 AQUA Peptide RPFIDEA[K] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, pig, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011443 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011443 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011443 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003106 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003106 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003106 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
MAB4343 Anti-SOX-2 Antibody 100 µg, Anti-SOX-2 Antibody detects level of SOX-2 & has been published & validated for use in IC, IH & WB. pricing
MAB4423 Anti-SOX-2 Antibody, clone 10H9.1 100 µg, Anti-SOX-2 Antibody, clone 10H9.1 detects level of SOX-2 & has been published & validated for use in WB & IC. pricing
MAB4423A4 Anti-SOX-2 Antibody, clone 10H9.1, Alexa Fluor® 488 conjugate 100 µL, Anti-SOX-2 Antibody, clone 10H9.1, Alexa Fluor 488 conjugate detects level of SOX-2 & has been published & validated for use in ICC. pricing
MAB4423C3 Anti-SOX-2 Antibody, clone 10H9.1, Cy3 conjugate 100 µL, Anti-SOX-2 Antibody, clone 10H9.1, Cy3 conjugate is an antibody against SOX-2 for use in ICC. pricing
AB5603A4 Anti-Sox2, Alexa Fluor® 488 Conjugate Antibody 100 µL, Detect Sox2 using this Anti-Sox2, Alexa Fluor 488 Conjugate Antibody validated for use in ICC. pricing
AB5603 Anti-Sox2 Antibody 100 µg, Anti-SOX2 Antibody, Cat. No. AB5603, is a highly specific rabbit polyclonal antibody SOX2 and has been tested for use in Immunocytochemistry, and Immunohistochemistry (Paraffin), and Western Blotting. pricing
17-10256 ChIPAb+™ SOX-2 - ChIP Validated Antibody and Primer Set 25 assays, This ChIPAb+ SOX-2 -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. pricing
SF-914 SOX2; Human, Cyanine3 RNA Detection Probe | SmartFlare 250 reactions, With SmartFlare™ RNA Detection probes, you can detect RNA in live cells. With an overnight incubation of SOX2; Human, Cyanine3 RNA Detection Probe you can detect the presence of SOX2 within your cells. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003106 Rosetta Predictions human pricing
NM_001109181 Rosetta Predictions rat pricing
NM_011443 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050572 predicted 1087
2 SASI_Hs01_00050573 predicted 1745
3 SASI_Hs01_00050580 predicted 1856
4 SASI_Hs01_00050574 predicted 1737
5 SASI_Hs01_00050575 predicted 1866
6 SASI_Hs01_00050576 predicted 1780
7 SASI_Hs02_00335074 predicted 1023
8 SASI_Hs01_00050577 predicted 875
9 SASI_Hs01_00050578 predicted 931
10 SASI_Hs01_00050579 predicted 771
11 SASI_Hs01_00050581 predicted 1553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245920 predicted 1023
2 SASI_Rn02_00245921 predicted 1179
3 SASI_Rn02_00245922 predicted 869
4 SASI_Rn02_00245923 predicted 820
5 SASI_Rn02_00245924 predicted 1090
6 SASI_Rn02_00245925 predicted 715
7 SASI_Rn02_00245926 predicted 829
8 SASI_Rn02_00245927 predicted 673
9 SASI_Rn02_00245928 predicted 838
10 SASI_Rn02_00245929 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011443 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093808 predicted 1074
2 SASI_Mm02_00320686 predicted 862
3 SASI_Mm02_00320687 predicted 1016
4 SASI_Mm01_00093811 predicted 883
5 SASI_Mm01_00093812 predicted 888
6 SASI_Mm01_00093813 predicted 771
7 SASI_Mm01_00093814 predicted 896
8 SASI_Mm01_00093815 predicted 882
9 SASI_Mm01_00093816 predicted 1139
10 SASI_Mm01_00093817 predicted 1030
11 SASI_Mm01_00093809 predicted 826
12 SASI_Mm01_00093810 predicted 966
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011443
SOX2 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 2
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000424718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011443.3-725s21c1
Sequence:CCGGAGGAGCACCCGGATTATAAATCTCGAGATTTATAATCCGGGTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011443.3-1408s21c1
Sequence:CCGGCAAAGAGATACAAGGGAATTGCTCGAGCAATTCCCTTGTATCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011443.3-1523s21c1
Sequence:CCGGACCAATCCCATCCAAATTAACCTCGAGGTTAATTTGGATGGGATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011443
SOX2 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 2
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000424718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011443.3-725s21c1
Sequence:CCGGAGGAGCACCCGGATTATAAATCTCGAGATTTATAATCCGGGTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011443.3-1408s21c1
Sequence:CCGGCAAAGAGATACAAGGGAATTGCTCGAGCAATTCCCTTGTATCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011443.3-1523s21c1
Sequence:CCGGACCAATCCCATCCAAATTAACCTCGAGGTTAATTTGGATGGGATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011443
SOX2 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 2
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000424718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011443.3-725s21c1
Sequence:CCGGAGGAGCACCCGGATTATAAATCTCGAGATTTATAATCCGGGTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011443.3-1408s21c1
Sequence:CCGGCAAAGAGATACAAGGGAATTGCTCGAGCAATTCCCTTGTATCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011443.3-1523s21c1
Sequence:CCGGACCAATCCCATCCAAATTAACCTCGAGGTTAATTTGGATGGGATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003106
VALIDATED
SOX2 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003106.2-1855s21c1
Sequence:CCGGGTACAGTATTTATCGAGATAACTCGAGTTATCTCGATAAATACTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_003106.2-1060s21c1
Sequence:CCGGCAGCTCGCAGACCTACATGAACTCGAGTTCATGTAGGTCTGCGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003106.2-928s21c1
Sequence:CCGGCAACGGCAGCTACAGCATGATCTCGAGATCATGCTGTAGCTGCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003106.2-735s21c1
Sequence:CCGGAGGAGCACCCGGATTATAAATCTCGAGATTTATAATCCGGGTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_003106.2-897s21c1
Sequence:CCGGTGGACAGTTACGCGCACATGACTCGAGTCATGTGCGCGTAACTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003106.2-1038s21c1
Sequence:CCGGCCCTGCAGTACAACTCCATGACTCGAGTCATGGAGTTGTACTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003106.2-1517s21c1
Sequence:CCGGTCCCATCACCCACAGCAAATGCTCGAGCATTTGCTGTGGGTGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003106.2-1089s21c1
Sequence:CCGGCCACCTACAGCATGTCCTACTCTCGAGAGTAGGACATGCTGTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003106.2-1305s21c1
Sequence:CCGGACATGTCCCAGCACTACCAGACTCGAGTCTGGTAGTGCTGGGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003106.2-780s21c1
Sequence:CCGGCGCTCATGAAGAAGGATAAGTCTCGAGACTTATCCTTCTTCATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003106.x-1060s1c1
Sequence:CCGGCAGCTCGCAGACCTACATGAACTCGAGTTCATGTAGGTCTGCGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003106.x-787s1c1
Sequence:CCGGGAAGAAGGATAAGTACACGCTCTCGAGAGCGTGTACTTATCCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003106.x-2378s1c1
Sequence:CCGGCTGCCGAGAATCCATGTATATCTCGAGATATACATGGATTCTCGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003106
VALIDATED
SOX2 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003106.2-1855s21c1
Sequence:CCGGGTACAGTATTTATCGAGATAACTCGAGTTATCTCGATAAATACTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_003106.2-1060s21c1
Sequence:CCGGCAGCTCGCAGACCTACATGAACTCGAGTTCATGTAGGTCTGCGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003106.2-928s21c1
Sequence:CCGGCAACGGCAGCTACAGCATGATCTCGAGATCATGCTGTAGCTGCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003106.2-735s21c1
Sequence:CCGGAGGAGCACCCGGATTATAAATCTCGAGATTTATAATCCGGGTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_003106.2-897s21c1
Sequence:CCGGTGGACAGTTACGCGCACATGACTCGAGTCATGTGCGCGTAACTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003106.2-1038s21c1
Sequence:CCGGCCCTGCAGTACAACTCCATGACTCGAGTCATGGAGTTGTACTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003106.2-1517s21c1
Sequence:CCGGTCCCATCACCCACAGCAAATGCTCGAGCATTTGCTGTGGGTGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003106.2-1089s21c1
Sequence:CCGGCCACCTACAGCATGTCCTACTCTCGAGAGTAGGACATGCTGTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003106.2-1305s21c1
Sequence:CCGGACATGTCCCAGCACTACCAGACTCGAGTCTGGTAGTGCTGGGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003106.2-780s21c1
Sequence:CCGGCGCTCATGAAGAAGGATAAGTCTCGAGACTTATCCTTCTTCATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003106.x-1060s1c1
Sequence:CCGGCAGCTCGCAGACCTACATGAACTCGAGTTCATGTAGGTCTGCGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003106.x-787s1c1
Sequence:CCGGGAAGAAGGATAAGTACACGCTCTCGAGAGCGTGTACTTATCCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003106.x-2378s1c1
Sequence:CCGGCTGCCGAGAATCCATGTATATCTCGAGATATACATGGATTCTCGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003106
VALIDATED
SOX2 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003106.2-1855s21c1
Sequence:CCGGGTACAGTATTTATCGAGATAACTCGAGTTATCTCGATAAATACTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_003106.2-1060s21c1
Sequence:CCGGCAGCTCGCAGACCTACATGAACTCGAGTTCATGTAGGTCTGCGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003106.2-928s21c1
Sequence:CCGGCAACGGCAGCTACAGCATGATCTCGAGATCATGCTGTAGCTGCCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003106.2-735s21c1
Sequence:CCGGAGGAGCACCCGGATTATAAATCTCGAGATTTATAATCCGGGTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_003106.2-897s21c1
Sequence:CCGGTGGACAGTTACGCGCACATGACTCGAGTCATGTGCGCGTAACTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003106.2-1038s21c1
Sequence:CCGGCCCTGCAGTACAACTCCATGACTCGAGTCATGGAGTTGTACTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003106.2-1517s21c1
Sequence:CCGGTCCCATCACCCACAGCAAATGCTCGAGCATTTGCTGTGGGTGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003106.2-1089s21c1
Sequence:CCGGCCACCTACAGCATGTCCTACTCTCGAGAGTAGGACATGCTGTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003106.2-1305s21c1
Sequence:CCGGACATGTCCCAGCACTACCAGACTCGAGTCTGGTAGTGCTGGGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003106.2-780s21c1
Sequence:CCGGCGCTCATGAAGAAGGATAAGTCTCGAGACTTATCCTTCTTCATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003106.x-1060s1c1
Sequence:CCGGCAGCTCGCAGACCTACATGAACTCGAGTTCATGTAGGTCTGCGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003106.x-787s1c1
Sequence:CCGGGAAGAAGGATAAGTACACGCTCTCGAGAGCGTGTACTTATCCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003106.x-2378s1c1
Sequence:CCGGCTGCCGAGAATCCATGTATATCTCGAGATATACATGGATTCTCGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks