EMAIL THIS PAGE TO A FRIEND

SOX30

SRY (sex determining region Y)-box 30

UniProtKB ID: O94993, O94995, Q8IYX6
Gene ID:
Human(11063) Summary: This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The protein may be involved in the differentiation of developing male germ cells. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(214105) SRY-box containing gene 30
Rat(689918) SRY (sex determining region Y)-box 30
chicken(416243) SRY (sex determining region Y)-box 30
dog(479316) SRY (sex determining region Y)-box 30
domestic cat(101090991) SRY (sex determining region Y)-box 30
naked mole-rat(101706675) SRY (sex determining region Y)-box 30
domestic guinea pig(100728157) SRY (sex determining region Y)-box 30
cow(538232) SRY (sex determining region Y)-box 30
sheep(101113849) SRY (sex determining region Y)-box 30
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007017 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007017 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007017 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173384 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173384 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173384 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007017 Rosetta Predictions human pricing
NM_178424 Rosetta Predictions human pricing
XM_001072526 Rosetta Predictions rat pricing
NM_173384 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007017 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029228 predicted 1442
2 SASI_Hs01_00029229 predicted 1025
3 SASI_Hs01_00029230 predicted 1454
4 SASI_Hs01_00029231 predicted 1318
5 SASI_Hs01_00029232 predicted 798
6 SASI_Hs01_00029233 predicted 1332
7 SASI_Hs01_00029234 predicted 1444
8 SASI_Hs01_00029235 predicted 1318
9 SASI_Hs01_00029236 predicted 1295
10 SASI_Hs01_00029237 predicted 1395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091175 predicted 1438
2 SASI_Hs01_00091176 predicted 1032
3 SASI_Hs01_00091177 predicted 1455
4 SASI_Hs01_00091178 predicted 1314
5 SASI_Hs01_00091179 predicted 806
6 SASI_Hs01_00091180 predicted 1334
7 SASI_Hs01_00091181 predicted 1437
8 SASI_Hs01_00091182 predicted 1320
9 SASI_Hs01_00091183 predicted 1293
10 SASI_Hs01_00091184 predicted 1396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339544 predicted 1696
2 SASI_Rn02_00339545 predicted 1063
3 SASI_Rn02_00339546 predicted 597
4 SASI_Rn02_00339547 predicted 1600
5 SASI_Rn02_00339548 predicted 775
6 SASI_Rn02_00339549 predicted 447
7 SASI_Rn02_00339550 predicted 746
8 SASI_Rn02_00339551 predicted 1760
9 SASI_Rn02_00339552 predicted 1831
10 SASI_Rn02_00339553 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170814 predicted 1393
2 SASI_Mm01_00170815 predicted 1938
3 SASI_Mm01_00170816 predicted 1088
4 SASI_Mm02_00345204 predicted 1441
5 SASI_Mm01_00170818 predicted 2038
6 SASI_Mm01_00170819 predicted 2096
7 SASI_Mm01_00170820 predicted 1099
8 SASI_Mm01_00170821 predicted 1203
9 SASI_Mm01_00170822 predicted 1052
10 SASI_Mm01_00170823 predicted 2046
11 SASI_Mm01_00170817 predicted 2427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007017
SOX30 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 30
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007017.2-1324s1c1
Sequence:CCGGCCCTTCAGTAAGGACAGAAATCTCGAGATTTCTGTCCTTACTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007017.2-1495s1c1
Sequence:CCGGCCCTATTACGATGAAGCACAACTCGAGTTGTGCTTCATCGTAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007017.2-1591s1c1
Sequence:CCGGCCTCTAAGTGTTTCCAATGTACTCGAGTACATTGGAAACACTTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007017.2-1452s1c1
Sequence:CCGGGCTTGGGTTAGAGTGGAACAACTCGAGTTGTTCCACTCTAACCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007017.2-1711s1c1
Sequence:CCGGCCCATCACTCATCCAGTTGTACTCGAGTACAACTGGATGAGTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007017
SOX30 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 30
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007017.2-1324s1c1
Sequence:CCGGCCCTTCAGTAAGGACAGAAATCTCGAGATTTCTGTCCTTACTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007017.2-1495s1c1
Sequence:CCGGCCCTATTACGATGAAGCACAACTCGAGTTGTGCTTCATCGTAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007017.2-1591s1c1
Sequence:CCGGCCTCTAAGTGTTTCCAATGTACTCGAGTACATTGGAAACACTTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007017.2-1452s1c1
Sequence:CCGGGCTTGGGTTAGAGTGGAACAACTCGAGTTGTTCCACTCTAACCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007017.2-1711s1c1
Sequence:CCGGCCCATCACTCATCCAGTTGTACTCGAGTACAACTGGATGAGTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007017
SOX30 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 30
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007017.2-1324s1c1
Sequence:CCGGCCCTTCAGTAAGGACAGAAATCTCGAGATTTCTGTCCTTACTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007017.2-1495s1c1
Sequence:CCGGCCCTATTACGATGAAGCACAACTCGAGTTGTGCTTCATCGTAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007017.2-1591s1c1
Sequence:CCGGCCTCTAAGTGTTTCCAATGTACTCGAGTACATTGGAAACACTTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007017.2-1452s1c1
Sequence:CCGGGCTTGGGTTAGAGTGGAACAACTCGAGTTGTTCCACTCTAACCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007017.2-1711s1c1
Sequence:CCGGCCCATCACTCATCCAGTTGTACTCGAGTACAACTGGATGAGTGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173384
SOX30 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 30
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173384.1-2485s1c1
Sequence:CCGGCCGTTCATGTCTTCCCAAGTTCTCGAGAACTTGGGAAGACATGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173384.1-862s1c1
Sequence:CCGGGCAAGACCTAAGGTTCCCTTTCTCGAGAAAGGGAACCTTAGGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173384.1-2108s1c1
Sequence:CCGGCCTTTCAGAGACTATCCAGATCTCGAGATCTGGATAGTCTCTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173384.1-1996s1c1
Sequence:CCGGGCCTCCCTTTGGCTATGGAAACTCGAGTTTCCATAGCCAAAGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173384.1-934s1c1
Sequence:CCGGGCCTTCTGAGTTGATACGGTTCTCGAGAACCGTATCAACTCAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173384
SOX30 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 30
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173384.1-2485s1c1
Sequence:CCGGCCGTTCATGTCTTCCCAAGTTCTCGAGAACTTGGGAAGACATGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173384.1-862s1c1
Sequence:CCGGGCAAGACCTAAGGTTCCCTTTCTCGAGAAAGGGAACCTTAGGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173384.1-2108s1c1
Sequence:CCGGCCTTTCAGAGACTATCCAGATCTCGAGATCTGGATAGTCTCTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173384.1-1996s1c1
Sequence:CCGGGCCTCCCTTTGGCTATGGAAACTCGAGTTTCCATAGCCAAAGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173384.1-934s1c1
Sequence:CCGGGCCTTCTGAGTTGATACGGTTCTCGAGAACCGTATCAACTCAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173384
SOX30 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 30
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173384.1-2485s1c1
Sequence:CCGGCCGTTCATGTCTTCCCAAGTTCTCGAGAACTTGGGAAGACATGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173384.1-862s1c1
Sequence:CCGGGCAAGACCTAAGGTTCCCTTTCTCGAGAAAGGGAACCTTAGGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173384.1-2108s1c1
Sequence:CCGGCCTTTCAGAGACTATCCAGATCTCGAGATCTGGATAGTCTCTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173384.1-1996s1c1
Sequence:CCGGGCCTCCCTTTGGCTATGGAAACTCGAGTTTCCATAGCCAAAGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173384.1-934s1c1
Sequence:CCGGGCCTTCTGAGTTGATACGGTTCTCGAGAACCGTATCAACTCAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks