EMAIL THIS PAGE TO A FRIEND

SOX3

SRY (sex determining region Y)-box 3

Synonyms: GHDX MRGH PHP PHPX SOXB
UniProtKB ID: P41225, P35714, Q5JWI3, Q9NP49
Gene ID:
Human(6658) Summary: This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. Mutations in this gene have been associated with X-linked mental retardation with growth hormone deficiency. [provided by RefSeq, Jul 2008]
Mouse(20675) SRY-box containing gene 3
Rat(367950) SRY-box containing gene 3
cow(781679) SRY (sex determining region Y)-box 3
domestic guinea pig(100731988) SRY (sex determining region Y)-box 3
naked mole-rat(101720375) SRY (sex determining region Y)-box 3
Zebrafish(30529) SRY-box containing gene 3
chicken(374019) SRY (sex determining region Y)-box 3
dog(492178) SRY (sex determining region Y)-box 3
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV38648 Anti-SOX3 (AB1) antibody produced in rabbit IgG fraction of antiserum rat, mouse, human
western blot pricing
AV38649 Anti-SOX3 (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, guinea pig, rat, zebrafish, canine, human, rabbit
western blot pricing
SAB2501626 Anti-SOX3 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, canine, pig, human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
S7443 Anti-Sox3 antibody produced in rabbit affinity isolated antibody, ammonium sulfate suspension human, rodent
immunohistochemistry, western blot pricing
AV33321 Anti-SOX3 antibody produced in rabbit affinity isolated antibody canine, rabbit, rat, human, mouse
western blot pricing
SAB2104042 Anti-SOX3 antibody produced in rabbit affinity isolated antibody rat, guinea pig, rabbit, canine, human, mouse
western blot pricing
HPA054720 Anti-SOX3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA075003 Anti-SOX3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0006658M4 Monoclonal Anti-SOX3 antibody produced in mouse clone 1F2, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, western blot pricing
AMAB91312 Monoclonal Anti-SOX3 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL4725, purified immunoglobulin New human
western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0314 AQUA Peptide RPFIDEA[K] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, pig, rat pricing
AQ0313 AQUA Peptide LLTDAE[K] dog, human, mouse, rat pricing
AQ0312 AQUA Peptide SEPSSPPPAIASHSQ[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009237 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009237 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009237 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005634 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005634 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005634 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005634 Rosetta Predictions human pricing
NM_009237 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339968 predicted 231
2 SASI_Hs01_00015718 predicted 1633
3 SASI_Hs01_00015719 predicted 1816
4 SASI_Hs01_00015720 predicted 1648
5 SASI_Hs02_00339969 predicted 1639
6 SASI_Hs01_00015721 predicted 408
7 SASI_Hs02_00339970 predicted 1674
8 SASI_Hs02_00339971 predicted 1706
9 SASI_Hs01_00015723 predicted 1827
10 SASI_Hs01_00015724 predicted 225
11 SASI_Hs01_00015717 predicted 1839
12 SASI_Hs01_00015722 predicted 1705
13 SASI_Hs01_00015725 predicted 1826
14 SASI_Hs01_00015726 predicted 1772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009237 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315707 predicted 1523
2 SASI_Mm02_00315708 predicted 1821
3 SASI_Mm01_00169512 predicted 822
4 SASI_Mm02_00315709 predicted 1802
5 SASI_Mm02_00315710 predicted 1638
6 SASI_Mm02_00315711 predicted 1637
7 SASI_Mm02_00315712 predicted 217
8 SASI_Mm02_00315713 predicted 1671
9 SASI_Mm01_00169514 predicted 898
10 SASI_Mm01_00169515 predicted 913
11 SASI_Mm01_00169513 predicted 252
12 SASI_Mm01_00169516 predicted 255
13 SASI_Mm01_00169517 predicted 561
14 SASI_Mm01_00169518 predicted 676
15 SASI_Mm01_00169519 predicted 571
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009237
SOX3 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009237.2-514s21c1
Sequence:CCGGTCCGAGATCAGCAAGCGCTTGCTCGAGCAAGCGCTTGCTGATCTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009237.2-614s21c1
Sequence:CCGGTGAAGGAGTACCCGGACTACACTCGAGTGTAGTCCGGGTACTCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009237.2-1675s21c1
Sequence:CCGGGTCTTGTTAGTTTGCTATTAACTCGAGTTAATAGCAAACTAACAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009237.1-672s1c1
Sequence:CCGGGCTGCCTCAGATGCACCGCTACTCGAGTAGCGGTGCATCTGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009237.1-90s1c1
Sequence:CCGGTGCAGGCAAGAGTGGCGCGAACTCGAGTTCGCGCCACTCTTGCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009237.1-555s1c1
Sequence:CCGGGCGCCTGGACACGTACACGCACTCGAGTGCGTGTACGTGTCCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009237.1-978s1c1
Sequence:CCGGGCGCGACATGATCAGCATGTACTCGAGTACATGCTGATCATGTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009237.1-321s1c1
Sequence:CCGGGAAACTGCTGACCGATGCGGACTCGAGTCCGCATCGGTCAGCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009237
SOX3 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009237.2-514s21c1
Sequence:CCGGTCCGAGATCAGCAAGCGCTTGCTCGAGCAAGCGCTTGCTGATCTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009237.2-614s21c1
Sequence:CCGGTGAAGGAGTACCCGGACTACACTCGAGTGTAGTCCGGGTACTCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009237.2-1675s21c1
Sequence:CCGGGTCTTGTTAGTTTGCTATTAACTCGAGTTAATAGCAAACTAACAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009237.1-672s1c1
Sequence:CCGGGCTGCCTCAGATGCACCGCTACTCGAGTAGCGGTGCATCTGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009237.1-90s1c1
Sequence:CCGGTGCAGGCAAGAGTGGCGCGAACTCGAGTTCGCGCCACTCTTGCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009237.1-555s1c1
Sequence:CCGGGCGCCTGGACACGTACACGCACTCGAGTGCGTGTACGTGTCCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009237.1-978s1c1
Sequence:CCGGGCGCGACATGATCAGCATGTACTCGAGTACATGCTGATCATGTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009237.1-321s1c1
Sequence:CCGGGAAACTGCTGACCGATGCGGACTCGAGTCCGCATCGGTCAGCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009237
SOX3 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009237.2-514s21c1
Sequence:CCGGTCCGAGATCAGCAAGCGCTTGCTCGAGCAAGCGCTTGCTGATCTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009237.2-614s21c1
Sequence:CCGGTGAAGGAGTACCCGGACTACACTCGAGTGTAGTCCGGGTACTCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009237.2-1675s21c1
Sequence:CCGGGTCTTGTTAGTTTGCTATTAACTCGAGTTAATAGCAAACTAACAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009237.1-672s1c1
Sequence:CCGGGCTGCCTCAGATGCACCGCTACTCGAGTAGCGGTGCATCTGAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009237.1-90s1c1
Sequence:CCGGTGCAGGCAAGAGTGGCGCGAACTCGAGTTCGCGCCACTCTTGCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009237.1-555s1c1
Sequence:CCGGGCGCCTGGACACGTACACGCACTCGAGTGCGTGTACGTGTCCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009237.1-978s1c1
Sequence:CCGGGCGCGACATGATCAGCATGTACTCGAGTACATGCTGATCATGTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009237.1-321s1c1
Sequence:CCGGGAAACTGCTGACCGATGCGGACTCGAGTCCGCATCGGTCAGCAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005634
SOX3 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005634.2-1405s21c1
Sequence:CCGGCAAGTTGGGACGCCTTGTTTACTCGAGTAAACAAGGCGTCCCAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005634.2-399s21c1
Sequence:CCGGTACAGACCAGGACCGTGTGAACTCGAGTTCACACGGTCCTGGTCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005634.2-1651s1c1
Sequence:CCGGCCAGGGTTATTCTGTTACATTCTCGAGAATGTAACAGAATAACCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005634.2-945s1c1
Sequence:CCGGCGGCGCTCAGAGCTACATGAACTCGAGTTCATGTAGCTCTGAGCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005634.2-589s1c1
Sequence:CCGGGCCGTGCACATGAAGGAGTATCTCGAGATACTCCTTCATGTGCACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005634.2-234s1c1
Sequence:CCGGCCTTCTGGAGACTGAACTCAACTCGAGTTGAGTTCAGTCTCCAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005634.2-315s1c1
Sequence:CCGGCGCAGGCAAGAGTAGTGCGAACTCGAGTTCGCACTACTCTTGCCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005634
SOX3 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005634.2-1405s21c1
Sequence:CCGGCAAGTTGGGACGCCTTGTTTACTCGAGTAAACAAGGCGTCCCAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005634.2-399s21c1
Sequence:CCGGTACAGACCAGGACCGTGTGAACTCGAGTTCACACGGTCCTGGTCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005634.2-1651s1c1
Sequence:CCGGCCAGGGTTATTCTGTTACATTCTCGAGAATGTAACAGAATAACCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005634.2-945s1c1
Sequence:CCGGCGGCGCTCAGAGCTACATGAACTCGAGTTCATGTAGCTCTGAGCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005634.2-589s1c1
Sequence:CCGGGCCGTGCACATGAAGGAGTATCTCGAGATACTCCTTCATGTGCACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005634.2-234s1c1
Sequence:CCGGCCTTCTGGAGACTGAACTCAACTCGAGTTGAGTTCAGTCTCCAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005634.2-315s1c1
Sequence:CCGGCGCAGGCAAGAGTAGTGCGAACTCGAGTTCGCACTACTCTTGCCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005634
SOX3 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005634.2-1405s21c1
Sequence:CCGGCAAGTTGGGACGCCTTGTTTACTCGAGTAAACAAGGCGTCCCAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005634.2-399s21c1
Sequence:CCGGTACAGACCAGGACCGTGTGAACTCGAGTTCACACGGTCCTGGTCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005634.2-1651s1c1
Sequence:CCGGCCAGGGTTATTCTGTTACATTCTCGAGAATGTAACAGAATAACCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005634.2-945s1c1
Sequence:CCGGCGGCGCTCAGAGCTACATGAACTCGAGTTCATGTAGCTCTGAGCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005634.2-589s1c1
Sequence:CCGGGCCGTGCACATGAAGGAGTATCTCGAGATACTCCTTCATGTGCACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005634.2-234s1c1
Sequence:CCGGCCTTCTGGAGACTGAACTCAACTCGAGTTGAGTTCAGTCTCCAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005634.2-315s1c1
Sequence:CCGGCGCAGGCAAGAGTAGTGCGAACTCGAGTTCGCACTACTCTTGCCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks