EMAIL THIS PAGE TO A FRIEND

SOX4

SRY (sex determining region Y)-box 4

Synonyms: EVI16
UniProtKB ID: Q06945
Gene ID:
Human(6659) Summary: This intronless gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins, such as syndecan binding protein (syntenin). The protein may function in the apoptosis pathway leading to cell death as well as to tumorigenesis and may mediate downstream effects of parathyroid hormone (PTH) and PTH-related protein (PTHrP) in bone development. The solution structure has been resolved for the HMG-box of a similar mouse protein. [provided by RefSeq, Jul 2008]
Mouse(20677) SRY-box containing gene 4
Rat(364712) SRY (sex determining region Y)-box 4
chicken(395143) SRY (sex determining region Y)-box 4
domestic cat(101089515) SRY (sex determining region Y)-box 4
dog(100687084) SRY (sex determining region Y)-box 4
cow(768313) SRY (sex determining region Y)-box 4
sheep(101110976) SRY (sex determining region Y)-box 4
domestic guinea pig(100733500) SRY (sex determining region Y)-box 4
159 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003107 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003107 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003107 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009238 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009238 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009238 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU049871 MISSION® esiRNA esiRNA targeting mouse Sox4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003107 Rosetta Predictions human pricing
XM_001068302 Rosetta Predictions rat pricing
XM_344594 Rosetta Predictions rat pricing
NM_009238 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188751 predicted 934
2 SASI_Hs01_00188752 predicted 1014
3 SASI_Hs01_00188753 predicted 862
4 SASI_Hs01_00188754 predicted 1021
5 SASI_Hs01_00188755 predicted 999
6 SASI_Hs01_00188756 predicted 929
7 SASI_Hs01_00188757 predicted 998
8 SASI_Hs01_00188758 predicted 861
9 SASI_Hs01_00188759 predicted 1004
10 SASI_Hs01_00188760 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068302 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324151 predicted 807
2 SASI_Rn02_00324152 predicted 355
3 SASI_Rn02_00324153 predicted 525
4 SASI_Rn02_00324154 predicted 526
5 SASI_Rn02_00324155 predicted 875
6 SASI_Rn02_00324156 predicted 827
7 SASI_Rn02_00324157 predicted 519
8 SASI_Rn02_00324158 predicted 258
9 SASI_Rn02_00324159 predicted 823
10 SASI_Rn02_00324160 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344594 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397302 predicted 2103
2 SASI_Rn02_00397303 predicted 1889
3 SASI_Rn02_00397304 predicted 2529
4 SASI_Rn02_00397305 predicted 1772
5 SASI_Rn02_00397306 predicted 2885
6 SASI_Rn02_00397307 predicted 2837
7 SASI_Rn02_00397308 predicted 2098
8 SASI_Rn02_00397309 predicted 2827
9 SASI_Rn02_00397310 predicted 2886
10 SASI_Rn02_00397311 predicted 2827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009238 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114970 predicted 1014
2 SASI_Mm01_00114971 predicted 2463
3 SASI_Mm01_00114972 predicted 959
4 SASI_Mm01_00114973 predicted 2407
5 SASI_Mm01_00114974 predicted 2461
6 SASI_Mm01_00114975 predicted 864
7 SASI_Mm01_00114976 predicted 2454
8 SASI_Mm01_00114977 predicted 1015
9 SASI_Mm01_00114978 predicted 2456
10 SASI_Mm01_00114979 predicted 951
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003107
VALIDATED
SOX4 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003107.2-4433s1c1
Sequence:CCGGCCTTTCTACTTGTCGCTAAATCTCGAGATTTAGCGACAAGTAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003107.2-1101s1c1
Sequence:CCGGAGCGACAAGATCCCTTTCATTCTCGAGAATGAAAGGGATCTTGTCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003107.2-962s1c1
Sequence:CCGGTGGGCACATCAAGCGACCCATCTCGAGATGGGTCGCTTGATGTGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003107.2-1664s1c1
Sequence:CCGGGAAGAAGGTGAAGCGCGTCTACTCGAGTAGACGCGCTTCACCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003107.2-2023s1c1
Sequence:CCGGCCAGCTCAAACTTTGAGAGCACTCGAGTGCTCTCAAAGTTTGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003107.2-4433s21c1
Sequence:CCGGCCTTTCTACTTGTCGCTAAATCTCGAGATTTAGCGACAAGTAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003107.2-1983s21c1
Sequence:CCGGTCCGACGACGAGTTCGAAGACCTCGAGGTCTTCGAACTCGTCGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_003107.2-1101s21c1
Sequence:CCGGAGCGACAAGATCCCTTTCATTCTCGAGAATGAAAGGGATCTTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003107.2-1079s21c1
Sequence:CCGGACGCTGGAAGCTGCTCAAAGACTCGAGTCTTTGAGCAGCTTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003107.2-1664s21c1
Sequence:CCGGGAAGAAGGTGAAGCGCGTCTACTCGAGTAGACGCGCTTCACCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003107
VALIDATED
SOX4 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003107.2-4433s1c1
Sequence:CCGGCCTTTCTACTTGTCGCTAAATCTCGAGATTTAGCGACAAGTAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003107.2-1101s1c1
Sequence:CCGGAGCGACAAGATCCCTTTCATTCTCGAGAATGAAAGGGATCTTGTCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003107.2-962s1c1
Sequence:CCGGTGGGCACATCAAGCGACCCATCTCGAGATGGGTCGCTTGATGTGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003107.2-1664s1c1
Sequence:CCGGGAAGAAGGTGAAGCGCGTCTACTCGAGTAGACGCGCTTCACCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003107.2-2023s1c1
Sequence:CCGGCCAGCTCAAACTTTGAGAGCACTCGAGTGCTCTCAAAGTTTGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003107.2-4433s21c1
Sequence:CCGGCCTTTCTACTTGTCGCTAAATCTCGAGATTTAGCGACAAGTAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003107.2-1983s21c1
Sequence:CCGGTCCGACGACGAGTTCGAAGACCTCGAGGTCTTCGAACTCGTCGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_003107.2-1101s21c1
Sequence:CCGGAGCGACAAGATCCCTTTCATTCTCGAGAATGAAAGGGATCTTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003107.2-1079s21c1
Sequence:CCGGACGCTGGAAGCTGCTCAAAGACTCGAGTCTTTGAGCAGCTTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003107.2-1664s21c1
Sequence:CCGGGAAGAAGGTGAAGCGCGTCTACTCGAGTAGACGCGCTTCACCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003107
VALIDATED
SOX4 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_003107.2-4433s1c1
Sequence:CCGGCCTTTCTACTTGTCGCTAAATCTCGAGATTTAGCGACAAGTAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003107.2-1101s1c1
Sequence:CCGGAGCGACAAGATCCCTTTCATTCTCGAGAATGAAAGGGATCTTGTCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003107.2-962s1c1
Sequence:CCGGTGGGCACATCAAGCGACCCATCTCGAGATGGGTCGCTTGATGTGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003107.2-1664s1c1
Sequence:CCGGGAAGAAGGTGAAGCGCGTCTACTCGAGTAGACGCGCTTCACCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003107.2-2023s1c1
Sequence:CCGGCCAGCTCAAACTTTGAGAGCACTCGAGTGCTCTCAAAGTTTGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003107.2-4433s21c1
Sequence:CCGGCCTTTCTACTTGTCGCTAAATCTCGAGATTTAGCGACAAGTAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003107.2-1983s21c1
Sequence:CCGGTCCGACGACGAGTTCGAAGACCTCGAGGTCTTCGAACTCGTCGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_003107.2-1101s21c1
Sequence:CCGGAGCGACAAGATCCCTTTCATTCTCGAGAATGAAAGGGATCTTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003107.2-1079s21c1
Sequence:CCGGACGCTGGAAGCTGCTCAAAGACTCGAGTCTTTGAGCAGCTTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003107.2-1664s21c1
Sequence:CCGGGAAGAAGGTGAAGCGCGTCTACTCGAGTAGACGCGCTTCACCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009238
VALIDATED
SOX4 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009238.1-1430s1c1
Sequence:CCGGCAAGAAAGTGAAGCACGTCTACTCGAGTAGACGTGCTTCACTTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009238.1-1284s1c1
Sequence:CCGGGCATCGTTCTCTCCAGAGCAACTCGAGTTGCTCTGGAGAGAACGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009238.1-1918s1c1
Sequence:CCGGGCGAGATGATCTCGGGAGATTCTCGAGAATCTCCCGAGATCATCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009238.1-950s1c1
Sequence:CCGGGCTGCTCAAGGACAGCGACAACTCGAGTTGTCGCTGTCCTTGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009238.1-1784s1c1
Sequence:CCGGCAGCTCAAACTTTGAGAGCATCTCGAGATGCTCTCAAAGTTTGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218406    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009238.2-2471s21c1
Sequence:GTACCGGTAAAGACCGAAGGAATCTTTCCTCGAGGAAAGATTCCTTCGGTCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009238.2-1924s21c1
Sequence:CCGGCGAGATGATCTCGGGAGATTGCTCGAGCAATCTCCCGAGATCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009238.2-1946s21c1
Sequence:CCGGCTGGAGTCCAGCATCTCTAACCTCGAGGTTAGAGATGCTGGACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009238.2-1443s21c1
Sequence:CCGGTGAAGCGCGTCTACCTGTTTGCTCGAGCAAACAGGTAGACGCGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009238.2-960s21c1
Sequence:CCGGTCAAGGACAGCGACAAGATTCCTCGAGGAATCTTGTCGCTGTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009238
VALIDATED
SOX4 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009238.1-1430s1c1
Sequence:CCGGCAAGAAAGTGAAGCACGTCTACTCGAGTAGACGTGCTTCACTTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009238.1-1284s1c1
Sequence:CCGGGCATCGTTCTCTCCAGAGCAACTCGAGTTGCTCTGGAGAGAACGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009238.1-1918s1c1
Sequence:CCGGGCGAGATGATCTCGGGAGATTCTCGAGAATCTCCCGAGATCATCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009238.1-950s1c1
Sequence:CCGGGCTGCTCAAGGACAGCGACAACTCGAGTTGTCGCTGTCCTTGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009238.1-1784s1c1
Sequence:CCGGCAGCTCAAACTTTGAGAGCATCTCGAGATGCTCTCAAAGTTTGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218406    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009238.2-2471s21c1
Sequence:GTACCGGTAAAGACCGAAGGAATCTTTCCTCGAGGAAAGATTCCTTCGGTCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009238.2-1924s21c1
Sequence:CCGGCGAGATGATCTCGGGAGATTGCTCGAGCAATCTCCCGAGATCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009238.2-1946s21c1
Sequence:CCGGCTGGAGTCCAGCATCTCTAACCTCGAGGTTAGAGATGCTGGACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009238.2-1443s21c1
Sequence:CCGGTGAAGCGCGTCTACCTGTTTGCTCGAGCAAACAGGTAGACGCGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009238.2-960s21c1
Sequence:CCGGTCAAGGACAGCGACAAGATTCCTCGAGGAATCTTGTCGCTGTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009238
VALIDATED
SOX4 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009238.1-1430s1c1
Sequence:CCGGCAAGAAAGTGAAGCACGTCTACTCGAGTAGACGTGCTTCACTTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009238.1-1284s1c1
Sequence:CCGGGCATCGTTCTCTCCAGAGCAACTCGAGTTGCTCTGGAGAGAACGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009238.1-1918s1c1
Sequence:CCGGGCGAGATGATCTCGGGAGATTCTCGAGAATCTCCCGAGATCATCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009238.1-950s1c1
Sequence:CCGGGCTGCTCAAGGACAGCGACAACTCGAGTTGTCGCTGTCCTTGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009238.1-1784s1c1
Sequence:CCGGCAGCTCAAACTTTGAGAGCATCTCGAGATGCTCTCAAAGTTTGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218406    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009238.2-2471s21c1
Sequence:GTACCGGTAAAGACCGAAGGAATCTTTCCTCGAGGAAAGATTCCTTCGGTCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009238.2-1924s21c1
Sequence:CCGGCGAGATGATCTCGGGAGATTGCTCGAGCAATCTCCCGAGATCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009238.2-1946s21c1
Sequence:CCGGCTGGAGTCCAGCATCTCTAACCTCGAGGTTAGAGATGCTGGACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009238.2-1443s21c1
Sequence:CCGGTGAAGCGCGTCTACCTGTTTGCTCGAGCAAACAGGTAGACGCGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009238.2-960s21c1
Sequence:CCGGTCAAGGACAGCGACAAGATTCCTCGAGGAATCTTGTCGCTGTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks