EMAIL THIS PAGE TO A FRIEND

SOX5

SRY (sex determining region Y)-box 5

Synonyms: L-SOX5
Gene ID:
Human(6660) Summary: This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The encoded protein may play a role in chondrogenesis. A pseudogene of this gene is located on chromosome 8. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(20678) SRY-box containing gene 5
Rat(140587) SRY (sex determining region Y)-box 5
Zebrafish(567413) SRY-box containing gene 5
chicken(418195) SRY (sex determining region Y)-box 5
Horse(100064442) SRY (sex determining region Y)-box 5
dog(486635) SRY (sex determining region Y)-box 5
domestic guinea pig(100715697) SRY (sex determining region Y)-box 5
naked mole-rat(101721694) SRY (sex determining region Y)-box 5
Domestic Rabbit(100348988) SRY (sex determining region Y)-box 5
cow(533829) SRY (sex determining region Y)-box 5
sheep(101115356) SRY (sex determining region Y)-box 5
199 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108483 Anti-SOX5 affinity isolated antibody horse, rat, canine, pig, mouse, human, guinea pig, bovine, rabbit
western blot pricing
AV33323 Anti-SOX5 antibody produced in rabbit affinity isolated antibody bovine, guinea pig, human, horse, rat, mouse, rabbit
immunohistochemistry, western blot pricing
SAB2106296 Anti-SOX5 antibody produced in rabbit affinity isolated antibody human, guinea pig, horse, rabbit
ELISA, western blot pricing
HPA060499 Anti-SOX5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB1412751 Monoclonal Anti-SOX5 antibody produced in mouse clone 4H8, purified immunoglobulin, 0.5 mg/mL human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011444 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011444 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011444 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006940 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006940 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006940 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031811 MISSION® esiRNA esiRNA human SOX5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006940 Rosetta Predictions human pricing
NM_152989 Rosetta Predictions human pricing
NM_178010 Rosetta Predictions human pricing
XM_342784 Rosetta Predictions rat pricing
NM_001113559 Rosetta Predictions mouse pricing
NM_011444 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140851 predicted 1944
2 SASI_Hs01_00140852 predicted 1795
3 SASI_Hs01_00140854 predicted 2068
4 SASI_Hs01_00140855 predicted 2321
5 SASI_Hs01_00140856 predicted 1711
6 SASI_Hs02_00342657 predicted 1759
7 SASI_Hs01_00140857 predicted 2179
8 SASI_Hs01_00140858 predicted 1671
9 SASI_Hs01_00140859 predicted 2268
10 SASI_Hs01_00140860 predicted 1850
11 SASI_Hs01_00140853 predicted 1658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049309 predicted 2183
2 SASI_Hs01_00049310 predicted 2022
3 SASI_Hs01_00049312 predicted 2296
4 SASI_Hs01_00049313 predicted 2557
5 SASI_Hs01_00049314 predicted 1948
6 SASI_Hs02_00366939 predicted 1987
7 SASI_Hs01_00049315 predicted 2409
8 SASI_Hs01_00049316 predicted 1904
9 SASI_Hs01_00049317 predicted 2496
10 SASI_Hs01_00049318 predicted 2081
11 SASI_Hs01_00049311 predicted 1892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114212 predicted 706
2 SASI_Hs01_00114213 predicted 554
3 SASI_Hs01_00114215 predicted 832
4 SASI_Hs01_00114216 predicted 1092
5 SASI_Hs01_00114217 predicted 480
6 SASI_Hs02_00369483 predicted 524
7 SASI_Hs01_00114218 predicted 940
8 SASI_Hs01_00114219 predicted 435
9 SASI_Hs01_00114220 predicted 1036
10 SASI_Hs01_00114221 predicted 606
11 SASI_Hs01_00114214 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342784 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394791 predicted 625
2 SASI_Rn02_00394792 predicted 591
3 SASI_Rn02_00394793 predicted 322
4 SASI_Rn02_00394794 predicted 340
5 SASI_Rn02_00394795 predicted 888
6 SASI_Rn02_00394796 predicted 242
7 SASI_Rn02_00394797 predicted 250
8 SASI_Rn02_00394798 predicted 242
9 SASI_Rn02_00394799 predicted 605
10 SASI_Rn02_00394800 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113559 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308189 predicted 2239
2 SASI_Mm02_00308190 predicted 2010
3 SASI_Mm02_00308191 predicted 2168
4 SASI_Mm02_00308192 predicted 1994
5 SASI_Mm02_00308193 predicted 468
6 SASI_Mm02_00308194 predicted 1600
7 SASI_Mm02_00308195 predicted 853
8 SASI_Mm02_00308196 predicted 1903
9 SASI_Mm02_00308197 predicted 1606
10 SASI_Mm02_00308198 predicted 1423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011444 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138571 predicted 2385
2 SASI_Mm01_00138574 predicted 2162
3 SASI_Mm01_00138575 predicted 2313
4 SASI_Mm02_00320688 predicted 2148
5 SASI_Mm02_00320689 predicted 465
6 SASI_Mm01_00138577 predicted 1750
7 SASI_Mm01_00138578 predicted 854
8 SASI_Mm02_00320690 predicted 2050
9 SASI_Mm02_00320691 predicted 1750
10 SASI_Mm01_00138579 predicted 1562
11 SASI_Mm01_00138570 predicted 1291
12 SASI_Mm01_00138572 predicted 1444
13 SASI_Mm01_00138573 predicted 1981
14 SASI_Mm01_00138576 predicted 395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011444
VALIDATED
SOX5 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011444.2-792s21c1
Sequence:CCGGAGCTCATGGGTATGATCAATCCTCGAGGATTGATCATACCCATGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011444.2-458s21c1
Sequence:CCGGATGGAAGTCGATGGCAATAAACTCGAGTTTATTGCCATCGACTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011444.1-2642s1c1
Sequence:CCGGCGAAATAAGCTATGGGTTAAACTCGAGTTTAACCCATAGCTTATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011444.1-1637s1c1
Sequence:CCGGGCAGTTAAACAGAATGAAGAACTCGAGTTCTTCATTCTGTTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011444.1-1898s1c1
Sequence:CCGGGCTATGACCAACCTAGAGAAACTCGAGTTTCTCTAGGTTGGTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011444.1-940s1c1
Sequence:CCGGGCCATTGATGATTCCCGTGTTCTCGAGAACACGGGAATCATCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011444.1-2308s1c1
Sequence:CCGGCGGAGAGATTTACGAGGAGTACTCGAGTACTCCTCGTAAATCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011444
VALIDATED
SOX5 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011444.2-792s21c1
Sequence:CCGGAGCTCATGGGTATGATCAATCCTCGAGGATTGATCATACCCATGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011444.2-458s21c1
Sequence:CCGGATGGAAGTCGATGGCAATAAACTCGAGTTTATTGCCATCGACTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011444.1-2642s1c1
Sequence:CCGGCGAAATAAGCTATGGGTTAAACTCGAGTTTAACCCATAGCTTATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011444.1-1637s1c1
Sequence:CCGGGCAGTTAAACAGAATGAAGAACTCGAGTTCTTCATTCTGTTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011444.1-1898s1c1
Sequence:CCGGGCTATGACCAACCTAGAGAAACTCGAGTTTCTCTAGGTTGGTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011444.1-940s1c1
Sequence:CCGGGCCATTGATGATTCCCGTGTTCTCGAGAACACGGGAATCATCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011444.1-2308s1c1
Sequence:CCGGCGGAGAGATTTACGAGGAGTACTCGAGTACTCCTCGTAAATCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011444
VALIDATED
SOX5 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011444.2-792s21c1
Sequence:CCGGAGCTCATGGGTATGATCAATCCTCGAGGATTGATCATACCCATGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011444.2-458s21c1
Sequence:CCGGATGGAAGTCGATGGCAATAAACTCGAGTTTATTGCCATCGACTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011444.1-2642s1c1
Sequence:CCGGCGAAATAAGCTATGGGTTAAACTCGAGTTTAACCCATAGCTTATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011444.1-1637s1c1
Sequence:CCGGGCAGTTAAACAGAATGAAGAACTCGAGTTCTTCATTCTGTTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011444.1-1898s1c1
Sequence:CCGGGCTATGACCAACCTAGAGAAACTCGAGTTTCTCTAGGTTGGTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011444.1-940s1c1
Sequence:CCGGGCCATTGATGATTCCCGTGTTCTCGAGAACACGGGAATCATCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011444.1-2308s1c1
Sequence:CCGGCGGAGAGATTTACGAGGAGTACTCGAGTACTCCTCGTAAATCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006940
SOX5 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006940.4-2260s1c1
Sequence:CCGGCCACATATCAAAGAAGAGATACTCGAGTATCTCTTCTTTGATATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006940.4-930s1c1
Sequence:CCGGGCCATTAATGATTCCCGTATTCTCGAGAATACGGGAATCATTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006940.4-1282s1c1
Sequence:CCGGCCACTGAACCTATCAGCTAAACTCGAGTTTAGCTGATAGGTTCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006940.4-3489s1c1
Sequence:CCGGGCACTTCAAATGACAACTTAACTCGAGTTAAGTTGTCATTTGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006940.4-1659s1c1
Sequence:CCGGCCATGCAATGATGGATTTCAACTCGAGTTGAAATCCATCATTGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006940
SOX5 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006940.4-2260s1c1
Sequence:CCGGCCACATATCAAAGAAGAGATACTCGAGTATCTCTTCTTTGATATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006940.4-930s1c1
Sequence:CCGGGCCATTAATGATTCCCGTATTCTCGAGAATACGGGAATCATTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006940.4-1282s1c1
Sequence:CCGGCCACTGAACCTATCAGCTAAACTCGAGTTTAGCTGATAGGTTCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006940.4-3489s1c1
Sequence:CCGGGCACTTCAAATGACAACTTAACTCGAGTTAAGTTGTCATTTGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006940.4-1659s1c1
Sequence:CCGGCCATGCAATGATGGATTTCAACTCGAGTTGAAATCCATCATTGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006940
SOX5 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006940.4-2260s1c1
Sequence:CCGGCCACATATCAAAGAAGAGATACTCGAGTATCTCTTCTTTGATATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006940.4-930s1c1
Sequence:CCGGGCCATTAATGATTCCCGTATTCTCGAGAATACGGGAATCATTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006940.4-1282s1c1
Sequence:CCGGCCACTGAACCTATCAGCTAAACTCGAGTTTAGCTGATAGGTTCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006940.4-3489s1c1
Sequence:CCGGGCACTTCAAATGACAACTTAACTCGAGTTAAGTTGTCATTTGAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006940.4-1659s1c1
Sequence:CCGGCCATGCAATGATGGATTTCAACTCGAGTTGAAATCCATCATTGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks