EMAIL THIS PAGE TO A FRIEND

SOX6

SRY (sex determining region Y)-box 6

Synonyms: HSSOX6 SOXD
UniProtKB ID: P35712, Q86VX7, Q9BXQ3, Q9BXQ4, Q9BXQ5, Q9H0I8
Gene ID:
Human(55553) Summary: This gene encodes a member of the D subfamily of sex determining region y-related transcription factors that are characterized by a conserved DNA-binding domain termed the high mobility group box and by their ability to bind the minor groove of DNA. The encoded protein is a transcriptional activator that is required for normal development of the central nervous system, chondrogenesis and maintenance of cardiac and skeletal muscle cells. The encoded protein interacts with other family members to cooperatively activate gene expression. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
Mouse(20679) SRY-box containing gene 6
Rat(293165) SRY (sex determining region Y)-box 6
Zebrafish(567154) SRY-box containing gene 6
Horse(100056348) SRY (sex determining region Y)-box 6
domestic cat(101095371) SRY (sex determining region Y)-box 6
dog(476871) SRY (sex determining region Y)-box 6
chicken(423068) SRY (sex determining region Y)-box 6
cow(534321) SRY (sex determining region Y)-box 6
sheep(101116170) SRY (sex determining region Y)-box 6
naked mole-rat(101697252) SRY (sex determining region Y)-box 6
domestic guinea pig(100715958) SRY (sex determining region Y)-box 6
247 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011445 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011445 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011445 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033326 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033326 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033326 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017508 Rosetta Predictions human pricing
NM_033326 Rosetta Predictions human pricing
NM_001024751 Rosetta Predictions rat pricing
NM_001025559 Rosetta Predictions mouse pricing
NM_001025560 Rosetta Predictions mouse pricing
NM_011445 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244324 predicted 2237
2 SASI_Hs02_00350121 predicted 764
3 SASI_Hs01_00244325 predicted 2458
4 SASI_Hs01_00244326 predicted 418
5 SASI_Hs01_00244327 predicted 2146
6 SASI_Hs01_00244329 predicted 835
7 SASI_Hs01_00244330 predicted 2150
8 SASI_Hs01_00244331 predicted 512
9 SASI_Hs01_00244332 predicted 2489
10 SASI_Hs01_00244333 predicted 890
11 SASI_Hs01_00244328 predicted 2448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218299 predicted 2132
2 SASI_Hs02_00361177 predicted 629
3 SASI_Hs01_00218300 predicted 2344
4 SASI_Hs01_00218301 predicted 287
5 SASI_Hs01_00218302 predicted 2038
6 SASI_Hs01_00218304 predicted 711
7 SASI_Hs01_00218305 predicted 2041
8 SASI_Hs01_00218306 predicted 379
9 SASI_Hs01_00218307 predicted 2375
10 SASI_Hs01_00218308 predicted 754
11 SASI_Hs01_00218303 predicted 2331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024751 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102065 predicted 2235
2 SASI_Rn01_00102066 predicted 364
3 SASI_Rn01_00102067 predicted 460
4 SASI_Rn01_00102068 predicted 1443
5 SASI_Rn01_00102069 predicted 2429
6 SASI_Rn01_00102070 predicted 2418
7 SASI_Rn01_00102071 predicted 390
8 SASI_Rn01_00102072 predicted 701
9 SASI_Rn01_00102073 predicted 2431
10 SASI_Rn01_00102074 predicted 2419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025559 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287888 predicted 2237
2 SASI_Mm02_00287889 predicted 367
3 SASI_Mm02_00287890 predicted 462
4 SASI_Mm02_00287891 predicted 1452
5 SASI_Mm02_00287892 predicted 2432
6 SASI_Mm02_00287893 predicted 2424
7 SASI_Mm02_00287894 predicted 2599
8 SASI_Mm02_00287895 predicted 396
9 SASI_Mm02_00287896 predicted 707
10 SASI_Mm02_00287897 predicted 2430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056217 predicted 2355
2 SASI_Mm02_00287898 predicted 493
3 SASI_Mm01_00056218 predicted 583
4 SASI_Mm01_00056219 predicted 1565
5 SASI_Mm01_00056220 predicted 2542
6 SASI_Mm01_00056221 predicted 2532
7 SASI_Mm02_00287899 predicted 2710
8 SASI_Mm01_00056222 predicted 516
9 SASI_Mm01_00056224 predicted 2546
10 SASI_Mm01_00056225 predicted 2532
11 SASI_Mm01_00056216 predicted 1889
12 SASI_Mm01_00056223 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199806 predicted 2387
2 SASI_Mm02_00320692 predicted 398
3 SASI_Mm01_00199807 predicted 494
4 SASI_Mm01_00199808 predicted 1598
5 SASI_Mm01_00199809 predicted 2574
6 SASI_Mm01_00199810 predicted 2572
7 SASI_Mm02_00320693 predicted 2753
8 SASI_Mm01_00199811 predicted 431
9 SASI_Mm01_00199813 predicted 2577
10 SASI_Mm01_00199814 predicted 2567
11 SASI_Mm01_00199805 predicted 1927
12 SASI_Mm01_00199812 predicted 739
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011445
VALIDATED
SOX6 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011445.1-1926s1c1
Sequence:CCGGGCAGCTAAACTACAGCAGTATCTCGAGATACTGCTGTAGTTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011445.1-1402s1c1
Sequence:CCGGCCAGCCCTGTAACTCAAGTTACTCGAGTAACTTGAGTTACAGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011445.1-433s1c1
Sequence:CCGGGTTCCCTATATTCCTTCCGAACTCGAGTTCGGAAGGAATATAGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011445.1-2708s1c1
Sequence:CCGGCCCAACAACAACAACAAAGTTCTCGAGAACTTTGTTGTTGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011445.1-2210s1c1
Sequence:CCGGCCACCTAGAGAAGTACCCAAACTCGAGTTTGGGTACTTCTCTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011445.3-2593s21c1
Sequence:CCGGTGATCCCAAATCAGACTATAGCTCGAGCTATAGTCTGATTTGGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011445.3-963s21c1
Sequence:CCGGCTCCGCTCATGATCCCAATTTCTCGAGAAATTGGGATCATGAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011445.3-433s21c1
Sequence:CCGGCCTATATTCCTTCCGAAATACCTCGAGGTATTTCGGAAGGAATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011445.3-2866s21c1
Sequence:CCGGATTTAGGTGAAGACGTATTAACTCGAGTTAATACGTCTTCACCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011445.3-2100s21c1
Sequence:GTACCGGACATGCATAACTCCAACATTACTCGAGTAATGTTGGAGTTATGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011445
VALIDATED
SOX6 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011445.1-1926s1c1
Sequence:CCGGGCAGCTAAACTACAGCAGTATCTCGAGATACTGCTGTAGTTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011445.1-1402s1c1
Sequence:CCGGCCAGCCCTGTAACTCAAGTTACTCGAGTAACTTGAGTTACAGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011445.1-433s1c1
Sequence:CCGGGTTCCCTATATTCCTTCCGAACTCGAGTTCGGAAGGAATATAGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011445.1-2708s1c1
Sequence:CCGGCCCAACAACAACAACAAAGTTCTCGAGAACTTTGTTGTTGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011445.1-2210s1c1
Sequence:CCGGCCACCTAGAGAAGTACCCAAACTCGAGTTTGGGTACTTCTCTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011445.3-2593s21c1
Sequence:CCGGTGATCCCAAATCAGACTATAGCTCGAGCTATAGTCTGATTTGGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011445.3-963s21c1
Sequence:CCGGCTCCGCTCATGATCCCAATTTCTCGAGAAATTGGGATCATGAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011445.3-433s21c1
Sequence:CCGGCCTATATTCCTTCCGAAATACCTCGAGGTATTTCGGAAGGAATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011445.3-2866s21c1
Sequence:CCGGATTTAGGTGAAGACGTATTAACTCGAGTTAATACGTCTTCACCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011445.3-2100s21c1
Sequence:GTACCGGACATGCATAACTCCAACATTACTCGAGTAATGTTGGAGTTATGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011445
VALIDATED
SOX6 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011445.1-1926s1c1
Sequence:CCGGGCAGCTAAACTACAGCAGTATCTCGAGATACTGCTGTAGTTTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011445.1-1402s1c1
Sequence:CCGGCCAGCCCTGTAACTCAAGTTACTCGAGTAACTTGAGTTACAGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011445.1-433s1c1
Sequence:CCGGGTTCCCTATATTCCTTCCGAACTCGAGTTCGGAAGGAATATAGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011445.1-2708s1c1
Sequence:CCGGCCCAACAACAACAACAAAGTTCTCGAGAACTTTGTTGTTGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011445.1-2210s1c1
Sequence:CCGGCCACCTAGAGAAGTACCCAAACTCGAGTTTGGGTACTTCTCTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011445.3-2593s21c1
Sequence:CCGGTGATCCCAAATCAGACTATAGCTCGAGCTATAGTCTGATTTGGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011445.3-963s21c1
Sequence:CCGGCTCCGCTCATGATCCCAATTTCTCGAGAAATTGGGATCATGAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011445.3-433s21c1
Sequence:CCGGCCTATATTCCTTCCGAAATACCTCGAGGTATTTCGGAAGGAATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011445.3-2866s21c1
Sequence:CCGGATTTAGGTGAAGACGTATTAACTCGAGTTAATACGTCTTCACCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011445.3-2100s21c1
Sequence:GTACCGGACATGCATAACTCCAACATTACTCGAGTAATGTTGGAGTTATGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033326
SOX6 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 6
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033326.1-230s1c1
Sequence:CCGGCCAACACTTGTCAGTACCATTCTCGAGAATGGTACTGACAAGTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033326.1-570s1c1
Sequence:CCGGCCAGTGAACTTCTTGGAGAAACTCGAGTTTCTCCAAGAAGTTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033326.1-1630s1c1
Sequence:CCGGCGGGAAACTGTCCTCCATAAACTCGAGTTTATGGAGGACAGTTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033326.1-386s1c1
Sequence:CCGGCGTGAGATAATGACCAGTGTTCTCGAGAACACTGGTCATTATCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033326.1-1855s1c1
Sequence:CCGGGCCACACATTAAGCGACCAATCTCGAGATTGGTCGCTTAATGTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033326.3-2616s21c1
Sequence:CCGGTGGTCTTAATTGTTTCGTAAACTCGAGTTTACGAAACAATTAAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033326
SOX6 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 6
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033326.1-230s1c1
Sequence:CCGGCCAACACTTGTCAGTACCATTCTCGAGAATGGTACTGACAAGTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033326.1-570s1c1
Sequence:CCGGCCAGTGAACTTCTTGGAGAAACTCGAGTTTCTCCAAGAAGTTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033326.1-1630s1c1
Sequence:CCGGCGGGAAACTGTCCTCCATAAACTCGAGTTTATGGAGGACAGTTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033326.1-386s1c1
Sequence:CCGGCGTGAGATAATGACCAGTGTTCTCGAGAACACTGGTCATTATCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033326.1-1855s1c1
Sequence:CCGGGCCACACATTAAGCGACCAATCTCGAGATTGGTCGCTTAATGTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033326.3-2616s21c1
Sequence:CCGGTGGTCTTAATTGTTTCGTAAACTCGAGTTTACGAAACAATTAAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033326
SOX6 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 6
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033326.1-230s1c1
Sequence:CCGGCCAACACTTGTCAGTACCATTCTCGAGAATGGTACTGACAAGTGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033326.1-570s1c1
Sequence:CCGGCCAGTGAACTTCTTGGAGAAACTCGAGTTTCTCCAAGAAGTTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033326.1-1630s1c1
Sequence:CCGGCGGGAAACTGTCCTCCATAAACTCGAGTTTATGGAGGACAGTTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033326.1-386s1c1
Sequence:CCGGCGTGAGATAATGACCAGTGTTCTCGAGAACACTGGTCATTATCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033326.1-1855s1c1
Sequence:CCGGGCCACACATTAAGCGACCAATCTCGAGATTGGTCGCTTAATGTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033326.3-2616s21c1
Sequence:CCGGTGGTCTTAATTGTTTCGTAAACTCGAGTTTACGAAACAATTAAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks