EMAIL THIS PAGE TO A FRIEND

SOX7

SRY (sex determining region Y)-box 7

UniProtKB ID: Q9BT81, Q53YD0
Gene ID:
Human(83595) Summary: This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The protein may play a role in tumorigenesis. A similar protein in mice is involved in the regulation of the wingless-type MMTV integration site family (Wnt) pathway. [provided by RefSeq, Jul 2008]
Mouse(20680) SRY-box containing gene 7
Rat(290317) SRY (sex determining region Y)-box 7
domestic guinea pig(100717892) SRY (sex determining region Y)-box 7
naked mole-rat(101703966) SRY (sex determining region Y)-box 7
cow(541256) SRY (sex determining region Y)-box 7
Zebrafish(394203) SRY-box containing gene 7
Horse(100062134) SRY (sex determining region Y)-box 7
domestic cat(101085626) SRY (sex determining region Y)-box 7
dog(486084) SRY (sex determining region Y)-box 7
chicken(771337) SRY (sex determining region Y)-box 7
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA009065 Anti-SOX7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV39667 Anti-SOX7 antibody produced in rabbit affinity isolated antibody horse, human, bovine, rat, rabbit, zebrafish, mouse, guinea pig, canine
western blot pricing
AV37139 Anti-SOX7 antibody produced in rabbit IgG fraction of antiserum rat, human, mouse
western blot pricing
SAB2103661 Anti-SOX7 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, rabbit, rat, human
western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1714 Human SOX7 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031439 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031439 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031439 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011446 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011446 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011446 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122021 MISSION® esiRNA esiRNA human SOX7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031439 Rosetta Predictions human pricing
NM_001106045 Rosetta Predictions rat pricing
NM_011446 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119447 predicted 1060
2 SASI_Hs01_00119448 predicted 1201
3 SASI_Hs01_00119449 predicted 1652
4 SASI_Hs01_00119450 predicted 1676
5 SASI_Hs01_00119451 predicted 680
6 SASI_Hs01_00119452 predicted 1152
7 SASI_Hs01_00119453 predicted 1006
8 SASI_Hs02_00358850 predicted 1062
9 SASI_Hs01_00119455 predicted 1379
10 SASI_Hs01_00119456 predicted 1214
11 SASI_Hs01_00119454 predicted 1608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106045 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215082 predicted 1055
2 SASI_Rn02_00215083 predicted 1683
3 SASI_Rn02_00215084 predicted 392
4 SASI_Rn02_00215085 predicted 1443
5 SASI_Rn02_00215086 predicted 1046
6 SASI_Rn02_00215087 predicted 1631
7 SASI_Rn02_00215088 predicted 1713
8 SASI_Rn02_00215089 predicted 496
9 SASI_Rn02_00215090 predicted 324
10 SASI_Rn02_00215091 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011446 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320694 predicted 1649
2 SASI_Mm02_00320695 predicted 996
3 SASI_Mm02_00320696 predicted 1013
4 SASI_Mm02_00320697 predicted 997
5 SASI_Mm02_00320698 predicted 1591
6 SASI_Mm02_00320699 predicted 1002
7 SASI_Mm02_00320700 predicted 1497
8 SASI_Mm02_00320701 predicted 865
9 SASI_Mm02_00320702 predicted 1545
10 SASI_Mm02_00320703 predicted 468
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031439
SOX7 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 7
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031439.2-1026s21c1
Sequence:CCGGATCAACTGAGCCAGGTGGAACCTCGAGGTTCCACCTGGCTCAGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031439.2-1546s21c1
Sequence:CCGGGTAGCCATCATCGAAACTAATCTCGAGATTAGTTTCGATGATGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031439.2-1064s1c1
Sequence:CCGGCGCAATGAATTCGACCAGTATCTCGAGATACTGGTCGAATTCATTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031439.2-140s1c1
Sequence:CCGGGCCGAGCTGTCGGATGGACAACTCGAGTTGTCCATCCGACAGCTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031439.2-950s1c1
Sequence:CCGGCCACTCCACTCCAACCTCCAACTCGAGTTGGAGGTTGGAGTGGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031439.2-796s1c1
Sequence:CCGGGCACCCGTACTCACCGGAGTACTCGAGTACTCCGGTGAGTACGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031439
SOX7 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 7
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031439.2-1026s21c1
Sequence:CCGGATCAACTGAGCCAGGTGGAACCTCGAGGTTCCACCTGGCTCAGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031439.2-1546s21c1
Sequence:CCGGGTAGCCATCATCGAAACTAATCTCGAGATTAGTTTCGATGATGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031439.2-1064s1c1
Sequence:CCGGCGCAATGAATTCGACCAGTATCTCGAGATACTGGTCGAATTCATTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031439.2-140s1c1
Sequence:CCGGGCCGAGCTGTCGGATGGACAACTCGAGTTGTCCATCCGACAGCTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031439.2-950s1c1
Sequence:CCGGCCACTCCACTCCAACCTCCAACTCGAGTTGGAGGTTGGAGTGGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031439.2-796s1c1
Sequence:CCGGGCACCCGTACTCACCGGAGTACTCGAGTACTCCGGTGAGTACGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031439
SOX7 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 7
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031439.2-1026s21c1
Sequence:CCGGATCAACTGAGCCAGGTGGAACCTCGAGGTTCCACCTGGCTCAGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031439.2-1546s21c1
Sequence:CCGGGTAGCCATCATCGAAACTAATCTCGAGATTAGTTTCGATGATGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031439.2-1064s1c1
Sequence:CCGGCGCAATGAATTCGACCAGTATCTCGAGATACTGGTCGAATTCATTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031439.2-140s1c1
Sequence:CCGGGCCGAGCTGTCGGATGGACAACTCGAGTTGTCCATCCGACAGCTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031439.2-950s1c1
Sequence:CCGGCCACTCCACTCCAACCTCCAACTCGAGTTGGAGGTTGGAGTGGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031439.2-796s1c1
Sequence:CCGGGCACCCGTACTCACCGGAGTACTCGAGTACTCCGGTGAGTACGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011446
SOX7 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 7
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011446.1-786s21c1
Sequence:CCGGAGCCACCCTCTAGGTTCTTTACTCGAGTAAAGAACCTAGAGGGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011446.1-1587s21c1
Sequence:CCGGGCTTGACCAGCCCTGACTATTCTCGAGAATAGTCAGGGCTGGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011446.1-1402s21c1
Sequence:CCGGGAGCTGTTTGCAGTAGGATTTCTCGAGAAATCCTACTGCAAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011446.1-1954s1c1
Sequence:CCGGCCCTGCATTATATGTGTGCTTCTCGAGAAGCACACATATAATGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011446.1-1118s1c1
Sequence:CCGGCCCTACAGAGACCAGCCTCATCTCGAGATGAGGCTGGTCTCTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011446.1-954s1c1
Sequence:CCGGCCTGGCTTTGACACCTTGGATCTCGAGATCCAAGGTGTCAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011446.1-1000s1c1
Sequence:CCGGGAGACATGGATCGCAATGAATCTCGAGATTCATTGCGATCCATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011446.1-1011s1c1
Sequence:CCGGCGCAATGAATTTGATCAGTATCTCGAGATACTGATCAAATTCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011446
SOX7 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 7
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011446.1-786s21c1
Sequence:CCGGAGCCACCCTCTAGGTTCTTTACTCGAGTAAAGAACCTAGAGGGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011446.1-1587s21c1
Sequence:CCGGGCTTGACCAGCCCTGACTATTCTCGAGAATAGTCAGGGCTGGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011446.1-1402s21c1
Sequence:CCGGGAGCTGTTTGCAGTAGGATTTCTCGAGAAATCCTACTGCAAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011446.1-1954s1c1
Sequence:CCGGCCCTGCATTATATGTGTGCTTCTCGAGAAGCACACATATAATGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011446.1-1118s1c1
Sequence:CCGGCCCTACAGAGACCAGCCTCATCTCGAGATGAGGCTGGTCTCTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011446.1-954s1c1
Sequence:CCGGCCTGGCTTTGACACCTTGGATCTCGAGATCCAAGGTGTCAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011446.1-1000s1c1
Sequence:CCGGGAGACATGGATCGCAATGAATCTCGAGATTCATTGCGATCCATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011446.1-1011s1c1
Sequence:CCGGCGCAATGAATTTGATCAGTATCTCGAGATACTGATCAAATTCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011446
SOX7 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 7
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011446.1-786s21c1
Sequence:CCGGAGCCACCCTCTAGGTTCTTTACTCGAGTAAAGAACCTAGAGGGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011446.1-1587s21c1
Sequence:CCGGGCTTGACCAGCCCTGACTATTCTCGAGAATAGTCAGGGCTGGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011446.1-1402s21c1
Sequence:CCGGGAGCTGTTTGCAGTAGGATTTCTCGAGAAATCCTACTGCAAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011446.1-1954s1c1
Sequence:CCGGCCCTGCATTATATGTGTGCTTCTCGAGAAGCACACATATAATGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011446.1-1118s1c1
Sequence:CCGGCCCTACAGAGACCAGCCTCATCTCGAGATGAGGCTGGTCTCTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011446.1-954s1c1
Sequence:CCGGCCTGGCTTTGACACCTTGGATCTCGAGATCCAAGGTGTCAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011446.1-1000s1c1
Sequence:CCGGGAGACATGGATCGCAATGAATCTCGAGATTCATTGCGATCCATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011446.1-1011s1c1
Sequence:CCGGCGCAATGAATTTGATCAGTATCTCGAGATACTGATCAAATTCATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks