EMAIL THIS PAGE TO A FRIEND

SOX8

SRY (sex determining region Y)-box 8

UniProtKB ID: P57073, Q9NZW2
Gene ID:
Human(30812) Summary: This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. This protein may be involved in brain development and function. Haploinsufficiency for this protein may contribute to the mental retardation found in haemoglobin H-related mental retardation (ART-16 syndrome). [provided by RefSeq, Jul 2008]
Mouse(20681) SRY-box containing gene 8
Rat(302993) SRY (sex determining region Y)-box 8
Zebrafish(386704) SRY-box containing gene 8
chicken(395483) SRY (sex determining region Y)-box 8
domestic cat(101090576) SRY (sex determining region Y)-box 8
dog(490082) SRY (sex determining region Y)-box 8
cow(530317) SRY (sex determining region Y)-box 8
naked mole-rat(101711198) SRY (sex determining region Y)-box 8
domestic guinea pig(100719276) SRY (sex determining region Y)-box 8
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011447 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011447 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011447 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014587 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014587 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014587 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU007581 MISSION® esiRNA esiRNA targeting mouse Sox8 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014587 Rosetta Predictions human pricing
NM_001106989 Rosetta Predictions rat pricing
NM_011447 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034119 predicted 1747
2 SASI_Hs01_00034120 predicted 902
3 SASI_Hs01_00034121 predicted 1680
4 SASI_Hs01_00034122 predicted 947
5 SASI_Hs02_00345866 predicted 715
6 SASI_Hs01_00034123 predicted 1490
7 SASI_Hs01_00034124 predicted 1700
8 SASI_Hs01_00034126 predicted 1247
9 SASI_Hs01_00034127 predicted 404
10 SASI_Hs01_00034128 predicted 1826
11 SASI_Hs01_00034125 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106989 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224386 predicted 2001
2 SASI_Rn02_00224387 predicted 1910
3 SASI_Rn02_00224388 predicted 1776
4 SASI_Rn02_00224389 predicted 1610
5 SASI_Rn02_00224390 predicted 423
6 SASI_Rn02_00224391 predicted 1970
7 SASI_Rn02_00224392 predicted 1424
8 SASI_Rn02_00224393 predicted 1556
9 SASI_Rn02_00224394 predicted 1544
10 SASI_Rn02_00224395 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011447 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110737 predicted 370
2 SASI_Mm01_00110738 predicted 1792
3 SASI_Mm02_00320704 predicted 987
4 SASI_Mm01_00110739 predicted 1766
5 SASI_Mm01_00110740 predicted 1424
6 SASI_Mm01_00110741 predicted 1237
7 SASI_Mm02_00320705 predicted 947
8 SASI_Mm01_00110742 predicted 1268
9 SASI_Mm01_00110743 predicted 1416
10 SASI_Mm01_00110744 predicted 1570
11 SASI_Mm01_00110745 predicted 1647
12 SASI_Mm01_00110746 predicted 530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011447
SOX8 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011447.1-655s1c1
Sequence:CCGGCCAGATTACAAATACCAGCCACTCGAGTGGCTGGTATTTGTAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011447.1-975s1c1
Sequence:CCGGCGAGGTTATCAGTAACATGGACTCGAGTCCATGTTACTGATAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011447.1-1008s1c1
Sequence:CCGGCCATGAATTTGACCAGTACTTCTCGAGAAGTACTGGTCAAATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011447.1-2506s1c1
Sequence:CCGGCCACGATAATCTTGGCTCTTTCTCGAGAAAGAGCCAAGATTATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011447.1-1005s1c1
Sequence:CCGGTGTCCATGAATTTGACCAGTACTCGAGTACTGGTCAAATTCATGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011447
SOX8 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011447.1-655s1c1
Sequence:CCGGCCAGATTACAAATACCAGCCACTCGAGTGGCTGGTATTTGTAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011447.1-975s1c1
Sequence:CCGGCGAGGTTATCAGTAACATGGACTCGAGTCCATGTTACTGATAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011447.1-1008s1c1
Sequence:CCGGCCATGAATTTGACCAGTACTTCTCGAGAAGTACTGGTCAAATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011447.1-2506s1c1
Sequence:CCGGCCACGATAATCTTGGCTCTTTCTCGAGAAAGAGCCAAGATTATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011447.1-1005s1c1
Sequence:CCGGTGTCCATGAATTTGACCAGTACTCGAGTACTGGTCAAATTCATGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011447
SOX8 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011447.1-655s1c1
Sequence:CCGGCCAGATTACAAATACCAGCCACTCGAGTGGCTGGTATTTGTAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011447.1-975s1c1
Sequence:CCGGCGAGGTTATCAGTAACATGGACTCGAGTCCATGTTACTGATAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011447.1-1008s1c1
Sequence:CCGGCCATGAATTTGACCAGTACTTCTCGAGAAGTACTGGTCAAATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011447.1-2506s1c1
Sequence:CCGGCCACGATAATCTTGGCTCTTTCTCGAGAAAGAGCCAAGATTATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011447.1-1005s1c1
Sequence:CCGGTGTCCATGAATTTGACCAGTACTCGAGTACTGGTCAAATTCATGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014587
SOX8 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014587.2-883s1c1
Sequence:CCGGCCAGAACATCGACTTCAGCAACTCGAGTTGCTGAAGTCGATGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014587.2-398s1c1
Sequence:CCGGGCGCTCAAAGCCAAGCCGCATCTCGAGATGCGGCTTGGCTTTGAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014587.2-635s1c1
Sequence:CCGGCGGCGCAGGAAGAGCGCCAAACTCGAGTTTGGCGCTCTTCCTGCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014587.2-958s1c1
Sequence:CCGGCGTCCACGAGTTCGACCAGTACTCGAGTACTGGTCGAACTCGTGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014587.2-1244s1c1
Sequence:CCGGGCCGGCTCACAGGGCGACTATCTCGAGATAGTCGCCCTGTGAGCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014587.3-1670s21c1
Sequence:CCGGTTTGAGGTGGTGGGATTATTCCTCGAGGAATAATCCCACCACCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014587.3-719s21c1
Sequence:CCGGTACAAGGCTGAAGCAGGGCTTCTCGAGAAGCCCTGCTTCAGCCTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014587.3-1692s21c1
Sequence:CCGGACAAAGAAGGGCTGCCGTTTGCTCGAGCAAACGGCAGCCCTTCTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014587.3-1272s21c1
Sequence:CCGGTGCAGGCCTCCAGCTACTATGCTCGAGCATAGTAGCTGGAGGCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014587
SOX8 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014587.2-883s1c1
Sequence:CCGGCCAGAACATCGACTTCAGCAACTCGAGTTGCTGAAGTCGATGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014587.2-398s1c1
Sequence:CCGGGCGCTCAAAGCCAAGCCGCATCTCGAGATGCGGCTTGGCTTTGAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014587.2-635s1c1
Sequence:CCGGCGGCGCAGGAAGAGCGCCAAACTCGAGTTTGGCGCTCTTCCTGCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014587.2-958s1c1
Sequence:CCGGCGTCCACGAGTTCGACCAGTACTCGAGTACTGGTCGAACTCGTGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014587.2-1244s1c1
Sequence:CCGGGCCGGCTCACAGGGCGACTATCTCGAGATAGTCGCCCTGTGAGCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014587.3-1670s21c1
Sequence:CCGGTTTGAGGTGGTGGGATTATTCCTCGAGGAATAATCCCACCACCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014587.3-719s21c1
Sequence:CCGGTACAAGGCTGAAGCAGGGCTTCTCGAGAAGCCCTGCTTCAGCCTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014587.3-1692s21c1
Sequence:CCGGACAAAGAAGGGCTGCCGTTTGCTCGAGCAAACGGCAGCCCTTCTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014587.3-1272s21c1
Sequence:CCGGTGCAGGCCTCCAGCTACTATGCTCGAGCATAGTAGCTGGAGGCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014587
SOX8 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014587.2-883s1c1
Sequence:CCGGCCAGAACATCGACTTCAGCAACTCGAGTTGCTGAAGTCGATGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014587.2-398s1c1
Sequence:CCGGGCGCTCAAAGCCAAGCCGCATCTCGAGATGCGGCTTGGCTTTGAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014587.2-635s1c1
Sequence:CCGGCGGCGCAGGAAGAGCGCCAAACTCGAGTTTGGCGCTCTTCCTGCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014587.2-958s1c1
Sequence:CCGGCGTCCACGAGTTCGACCAGTACTCGAGTACTGGTCGAACTCGTGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014587.2-1244s1c1
Sequence:CCGGGCCGGCTCACAGGGCGACTATCTCGAGATAGTCGCCCTGTGAGCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014587.3-1670s21c1
Sequence:CCGGTTTGAGGTGGTGGGATTATTCCTCGAGGAATAATCCCACCACCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014587.3-719s21c1
Sequence:CCGGTACAAGGCTGAAGCAGGGCTTCTCGAGAAGCCCTGCTTCAGCCTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014587.3-1692s21c1
Sequence:CCGGACAAAGAAGGGCTGCCGTTTGCTCGAGCAAACGGCAGCCCTTCTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014587.3-1272s21c1
Sequence:CCGGTGCAGGCCTCCAGCTACTATGCTCGAGCATAGTAGCTGGAGGCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks