EMAIL THIS PAGE TO A FRIEND

SOX9

SRY (sex determining region Y)-box 9

Synonyms: CMD1 CMPD1 SRA1
UniProtKB ID: P48436, Q53Y80
Gene ID:
Human(6662) Summary: The protein encoded by this gene recognizes the sequence CCTTGAG along with other members of the HMG-box class DNA-binding proteins. It acts during chondrocyte differentiation and, with steroidogenic factor 1, regulates transcription of the anti-Muellerian hormone (AMH) gene. Deficiencies lead to the skeletal malformation syndrome campomelic dysplasia, frequently with sex reversal. [provided by RefSeq, Jul 2008]
Mouse(20682) SRY-box containing gene 9
Rat(140586) SRY (sex determining region Y)-box 9
naked mole-rat(101714584) SRY (sex determining region Y)-box 9
Domestic Rabbit(100008944) SRY (sex determining region Y)-box 9
cow(100336535) SRY (sex determining region Y)-box 9
sheep(101107975) SRY (sex determining region Y)-box 9
chicken(374148) SRY (sex determining region Y)-box 9
dog(403464) SRY (sex determining region Y)-box 9
Horse(100033908) SRY (sex determining region Y)-box 9
143 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503991 Anti-phospho-SOX-9 (pSer181) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4301521 Anti-phospho-SOX-9 (pSer181) antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
SAB1300535 Anti-SOX9 (N-term) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412499 ANTI-SOX9 antibody produced in mouse clone 2A2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA001758 Anti-SOX9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
AV37986 Anti-SOX9 antibody produced in rabbit affinity isolated antibody canine, rat, horse, rabbit, pig, mouse, human, guinea pig
western blot pricing
AV100797 Anti-SOX9 antibody produced in rabbit IgG fraction of antiserum bovine, mouse, zebrafish, human, goat, rabbit, rat, canine, guinea pig
western blot pricing
SAB4502834 Anti-SOX9 antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
WH0006662M2 Monoclonal Anti-SOX9 antibody produced in mouse clone 3C10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
AMAB90795 Monoclonal Anti-SOX9 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0639, purified immunoglobulin, buffered aqueous glycerol solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB5300368 Monoclonal Anti-SOX9 antibody produced in mouse clone 1B11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404394 Monoclonal Anti-SOX9, (C-terminal) antibody produced in mouse clone 3F11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1715 Human SOX9 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000346 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000346 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000346 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011448 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011448 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011448 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
AB5535 Anti-Sox9 Antibody 100 µg, Anti-Sox9 Antibody is a well characterized affinity purified Rabbit Polyclonal Antibody that reliably detects Transcription Factor Sox-9. This highly published antibody has been validated in IHC & WB. pricing
ABE571 Anti-SOX9 Antibody 100 µg, Anti-SOX9 Antibody is a highly specific rabbit polyclonal antibody, that targets SOX9 & has been tested in western blotting, IHC & Immunofluorescence. pricing
AB5535-AF488 Anti-Sox9 Antibody, Alexa Fluor® 488 conjugate 100 µL, This Anti-Sox9 Antibody, Alexa Fluor® 488 conjugate is validated for use in Immunocytochemistry for the detection of Sox9. pricing
AB5535-AF555 Anti-Sox9 Antibody, Alexa Fluor® 555 conjugate 100 µL, This Anti-Sox9 Antibody, Alexa Fluor® 555 conjugate is validated for use in Immunocytochemistry for the detection of Sox9. pricing
MABC672 Anti-SOX9 Antibody, clone 1B11 100 µL, Detect SOX9 using this mouse monoclonal antibody, Anti-SOX9 Antibody, clone 1B11 validated for use in western blotting & Immunofluorescence. pricing
MABC785 Anti-SOX9 Antibody, clone 4B7.1 100 µL, Detect SOX9 using this mouse monoclonal Anti-SOX9, clone 4B7.1 Antibody, Cat. No. MABC785, validated for use in Immunohistochemistry (Paraffin) and Western Blotting. pricing
SF-1011 SOX9; Human, Cyanine 5, RNA Detection Probe | SmartFlare 250 reactions, Use SmartFlare RNA Detection probes to measure gene expression in live cells. With an overnight incubation of SmartFlare SOX9, Human, Cyanine 5, you can detect SOX9 RNA levels within your cells. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000346 Rosetta Predictions human pricing
XM_001081628 Rosetta Predictions rat pricing
XM_343981 Rosetta Predictions rat pricing
NM_011448 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240733 predicted 2226
2 SASI_Hs02_00302379 predicted 2227
3 SASI_Hs01_00240726 predicted 896
4 SASI_Hs02_00302380 predicted 2263
5 SASI_Hs02_00302381 predicted 2257
6 SASI_Hs01_00240728 predicted 649
7 SASI_Hs01_00240729 predicted 799
8 SASI_Hs01_00240730 predicted 1005
9 SASI_Hs01_00240731 predicted 1171
10 SASI_Hs01_00240732 predicted 1752
11 SASI_Hs01_00240727 predicted 796
12 SASI_Hs01_00240734 predicted 2265
13 SASI_Hs01_00240735 predicted 2236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081628 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372736 predicted 767
2 SASI_Rn02_00372737 predicted 1220
3 SASI_Rn02_00372738 predicted 1070
4 SASI_Rn02_00372739 predicted 719
5 SASI_Rn02_00372740 predicted 1065
6 SASI_Rn02_00372741 predicted 1228
7 SASI_Rn02_00372742 predicted 1312
8 SASI_Rn02_00372743 predicted 1301
9 SASI_Rn02_00372744 predicted 290
10 SASI_Rn02_00372745 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00152589 predicted 431
2 SASI_Rn01_00152590 predicted 439
3 SASI_Rn01_00152591 predicted 392
4 SASI_Rn01_00152592 predicted 479
5 SASI_Rn01_00152594 predicted 394
6 SASI_Rn02_00396625 predicted 727
7 SASI_Rn01_00152596 predicted 40
8 SASI_Rn02_00396626 predicted 50
9 SASI_Rn01_00152597 predicted 91
10 SASI_Rn01_00152598 predicted 127
11 SASI_Rn01_00152593 predicted 404
12 SASI_Rn01_00152595 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320706 predicted 655
2 SASI_Mm01_00163365 predicted 922
3 SASI_Mm01_00163366 predicted 951
4 SASI_Mm01_00163368 predicted 940
5 SASI_Mm01_00163369 predicted 956
6 SASI_Mm01_00163370 predicted 1116
7 SASI_Mm01_00163371 predicted 778
8 SASI_Mm01_00163372 predicted 959
9 SASI_Mm01_00163373 predicted 1007
10 SASI_Mm01_00163374 predicted 650
11 SASI_Mm01_00163367 predicted 1102
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000346
SOX9 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000346.3-903s21c1
Sequence:CCGGGCGGAGGAAGTCGGTGAAGAACTCGAGTTCTTCACCGACTTCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000346.3-1234s21c1
Sequence:CCGGACCTTCGATGTCAACGAGTTTCTCGAGAAACTCGTTGACATCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000346.3-804s21c1
Sequence:CCGGACTTCTGAACGAGAGCGAGAACTCGAGTTCTCGCTCTCGTTCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000346.3-1761s21c1
Sequence:CCGGCTCCACCTTCACCTACATGAACTCGAGTTCATGTAGGTGAAGGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000346.3-3680s21c1
Sequence:CCGGGCATCCTTCAATTTCTGTATACTCGAGTATACAGAAATTGAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000346.2-1234s1c1
Sequence:CCGGACCTTCGATGTCAACGAGTTTCTCGAGAAACTCGTTGACATCGAAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000346.2-1761s1c1
Sequence:CCGGCTCCACCTTCACCTACATGAACTCGAGTTCATGTAGGTGAAGGTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000346.2-804s1c1
Sequence:CCGGACTTCTGAACGAGAGCGAGAACTCGAGTTCTCGCTCTCGTTCAGAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000346.2-3680s1c1
Sequence:CCGGGCATCCTTCAATTTCTGTATACTCGAGTATACAGAAATTGAAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000346.2-903s1c1
Sequence:CCGGGCGGAGGAAGTCGGTGAAGAACTCGAGTTCTTCACCGACTTCCTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000346
SOX9 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000346.3-903s21c1
Sequence:CCGGGCGGAGGAAGTCGGTGAAGAACTCGAGTTCTTCACCGACTTCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000346.3-1234s21c1
Sequence:CCGGACCTTCGATGTCAACGAGTTTCTCGAGAAACTCGTTGACATCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000346.3-804s21c1
Sequence:CCGGACTTCTGAACGAGAGCGAGAACTCGAGTTCTCGCTCTCGTTCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000346.3-1761s21c1
Sequence:CCGGCTCCACCTTCACCTACATGAACTCGAGTTCATGTAGGTGAAGGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000346.3-3680s21c1
Sequence:CCGGGCATCCTTCAATTTCTGTATACTCGAGTATACAGAAATTGAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000346.2-1234s1c1
Sequence:CCGGACCTTCGATGTCAACGAGTTTCTCGAGAAACTCGTTGACATCGAAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000346.2-1761s1c1
Sequence:CCGGCTCCACCTTCACCTACATGAACTCGAGTTCATGTAGGTGAAGGTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000346.2-804s1c1
Sequence:CCGGACTTCTGAACGAGAGCGAGAACTCGAGTTCTCGCTCTCGTTCAGAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000346.2-3680s1c1
Sequence:CCGGGCATCCTTCAATTTCTGTATACTCGAGTATACAGAAATTGAAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000346.2-903s1c1
Sequence:CCGGGCGGAGGAAGTCGGTGAAGAACTCGAGTTCTTCACCGACTTCCTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000346
SOX9 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000346.3-903s21c1
Sequence:CCGGGCGGAGGAAGTCGGTGAAGAACTCGAGTTCTTCACCGACTTCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000346.3-1234s21c1
Sequence:CCGGACCTTCGATGTCAACGAGTTTCTCGAGAAACTCGTTGACATCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000346.3-804s21c1
Sequence:CCGGACTTCTGAACGAGAGCGAGAACTCGAGTTCTCGCTCTCGTTCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000346.3-1761s21c1
Sequence:CCGGCTCCACCTTCACCTACATGAACTCGAGTTCATGTAGGTGAAGGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000346.3-3680s21c1
Sequence:CCGGGCATCCTTCAATTTCTGTATACTCGAGTATACAGAAATTGAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000346.2-1234s1c1
Sequence:CCGGACCTTCGATGTCAACGAGTTTCTCGAGAAACTCGTTGACATCGAAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000346.2-1761s1c1
Sequence:CCGGCTCCACCTTCACCTACATGAACTCGAGTTCATGTAGGTGAAGGTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000346.2-804s1c1
Sequence:CCGGACTTCTGAACGAGAGCGAGAACTCGAGTTCTCGCTCTCGTTCAGAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000346.2-3680s1c1
Sequence:CCGGGCATCCTTCAATTTCTGTATACTCGAGTATACAGAAATTGAAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000346.2-903s1c1
Sequence:CCGGGCGGAGGAAGTCGGTGAAGAACTCGAGTTCTTCACCGACTTCCTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011448
VALIDATED
SOX9 MISSION shRNA Bacterial Glycerol Stock
SRY (sex determining region Y)-box 9
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011448.4-1214s21c1
Sequence:CCGGGCGACGTCATCTCCAACATTGCTCGAGCAATGTTGGAGATGACGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011448.4-2111s21c1
Sequence:CCGGCTGAGCTCATGACAACATATTCTCGAGAATATGTTGTCATGAGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011448.4-1753s21c1
Sequence:CCGGCTCTACTCCACCTTCACTTACCTCGAGGTAAGTGAAGGTGGAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011448.4-1238s21c1
Sequence:CCGGCCTTCGACGTCAATGAGTTTGCTCGAGCAAACTCATTGACGTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011448.4-959s21c1
Sequence:CCGGAGACTCACATCTCTCCTAATGCTCGAGCATTAGGAGAGATGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011448.2-2239s1c1
Sequence:CCGGCCTGCCTGTTTGGACTTTGTACTCGAGTACAAAGTCCAAACAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011448.2-1744s1c1
Sequence:CCGGCTCCACCTTCACTTACATGAACTCGAGTTCATGTAAGTGAAGGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011448.2-1231s1c1
Sequence:CCGGCGTCAATGAGTTTGACCAATACTCGAGTATTGGTCAAACTCATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011448.2-1234s1c1
Sequence:CCGGCAATGAGTTTGACCAATACTTCTCGAGAAGTATTGGTCAAACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011448.2-944s1c1
Sequence:CCGGCAGACTCACATCTCTCCTAATCTCGAGATTAGGAGAGATGTGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011448
VALIDATED
SOX9 MISSION shRNA shRNA Plasmid DNA
SRY (sex determining region Y)-box 9
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011448.4-1214s21c1
Sequence:CCGGGCGACGTCATCTCCAACATTGCTCGAGCAATGTTGGAGATGACGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011448.4-2111s21c1
Sequence:CCGGCTGAGCTCATGACAACATATTCTCGAGAATATGTTGTCATGAGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011448.4-1753s21c1
Sequence:CCGGCTCTACTCCACCTTCACTTACCTCGAGGTAAGTGAAGGTGGAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011448.4-1238s21c1
Sequence:CCGGCCTTCGACGTCAATGAGTTTGCTCGAGCAAACTCATTGACGTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011448.4-959s21c1
Sequence:CCGGAGACTCACATCTCTCCTAATGCTCGAGCATTAGGAGAGATGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011448.2-2239s1c1
Sequence:CCGGCCTGCCTGTTTGGACTTTGTACTCGAGTACAAAGTCCAAACAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011448.2-1744s1c1
Sequence:CCGGCTCCACCTTCACTTACATGAACTCGAGTTCATGTAAGTGAAGGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011448.2-1231s1c1
Sequence:CCGGCGTCAATGAGTTTGACCAATACTCGAGTATTGGTCAAACTCATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011448.2-1234s1c1
Sequence:CCGGCAATGAGTTTGACCAATACTTCTCGAGAAGTATTGGTCAAACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011448.2-944s1c1
Sequence:CCGGCAGACTCACATCTCTCCTAATCTCGAGATTAGGAGAGATGTGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011448
VALIDATED
SOX9 MISSION shRNA Lentiviral Transduction Particles
SRY (sex determining region Y)-box 9
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011448.4-1214s21c1
Sequence:CCGGGCGACGTCATCTCCAACATTGCTCGAGCAATGTTGGAGATGACGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011448.4-2111s21c1
Sequence:CCGGCTGAGCTCATGACAACATATTCTCGAGAATATGTTGTCATGAGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011448.4-1753s21c1
Sequence:CCGGCTCTACTCCACCTTCACTTACCTCGAGGTAAGTGAAGGTGGAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011448.4-1238s21c1
Sequence:CCGGCCTTCGACGTCAATGAGTTTGCTCGAGCAAACTCATTGACGTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011448.4-959s21c1
Sequence:CCGGAGACTCACATCTCTCCTAATGCTCGAGCATTAGGAGAGATGTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011448.2-2239s1c1
Sequence:CCGGCCTGCCTGTTTGGACTTTGTACTCGAGTACAAAGTCCAAACAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011448.2-1744s1c1
Sequence:CCGGCTCCACCTTCACTTACATGAACTCGAGTTCATGTAAGTGAAGGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011448.2-1231s1c1
Sequence:CCGGCGTCAATGAGTTTGACCAATACTCGAGTATTGGTCAAACTCATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011448.2-1234s1c1
Sequence:CCGGCAATGAGTTTGACCAATACTTCTCGAGAAGTATTGGTCAAACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011448.2-944s1c1
Sequence:CCGGCAGACTCACATCTCTCCTAATCTCGAGATTAGGAGAGATGTGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks