EMAIL THIS PAGE TO A FRIEND

SP100

SP100 nuclear antigen

Synonyms: lysp100b
Gene ID:
Human(6672) Summary: This gene encodes a subnuclear organelle and major component of the PML (promyelocytic leukemia)-SP100 nuclear bodies. PML and SP100 are covalently modified by the SUMO-1 modifier, which is considered crucial to nuclear body interactions. The encoded protein binds heterochromatin proteins and is thought to play a role in tumorigenesis, immunity, and gene regulation. Alternatively spliced variants have been identified for this gene; one of which encodes a high-mobility group protein. [provided by RefSeq, Aug 2011]
Mouse(20684) nuclear antigen Sp100
Rat(363269) SP100 nuclear antigen
domestic cat(101093955) SP100 nuclear antigen
Horse(100063667) SP100 nuclear antigen
dog(477402) SP100 nuclear antigen
domestic guinea pig(100727417) SP100 nuclear antigen
naked mole-rat(101725529) SP100 nuclear antigen
cow(100140338) SP100 nuclear antigen
sheep(101120993) SP100 nuclear antigen
142 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003113 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003113 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003113 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013673 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013673 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013673 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080391 Rosetta Predictions human pricing
NM_003113 Rosetta Predictions human pricing
NM_001014220 Rosetta Predictions rat pricing
NM_013673 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314401 predicted 1477
2 SASI_Hs02_00314402 predicted 1976
3 SASI_Hs02_00314403 predicted 1099
4 SASI_Hs02_00314404 predicted 268
5 SASI_Hs02_00314405 predicted 1094
6 SASI_Hs02_00314406 predicted 2006
7 SASI_Hs02_00314407 predicted 1649
8 SASI_Hs02_00314408 predicted 1678
9 SASI_Hs02_00314409 predicted 887
10 SASI_Hs02_00314410 predicted 1083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156862 predicted 1481
2 SASI_Hs01_00156863 predicted 1981
3 SASI_Hs02_00335079 predicted 1101
4 SASI_Hs02_00335080 predicted 266
5 SASI_Hs02_00335081 predicted 1099
6 SASI_Hs01_00156865 predicted 2008
7 SASI_Hs01_00156866 predicted 1653
8 SASI_Hs01_00156867 predicted 1679
9 SASI_Hs01_00156868 predicted 886
10 SASI_Hs01_00156869 predicted 1089
11 SASI_Hs01_00156861 predicted 539
12 SASI_Hs01_00156864 predicted 373
13 SASI_Hs01_00156870 predicted 1920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014220 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122187 predicted 945
2 SASI_Rn02_00201754 predicted 783
3 SASI_Rn01_00122188 predicted 954
4 SASI_Rn02_00201755 predicted 617
5 SASI_Rn01_00122189 predicted 842
6 SASI_Rn01_00122190 predicted 315
7 SASI_Rn01_00122191 predicted 275
8 SASI_Rn02_00201756 predicted 284
9 SASI_Rn01_00122194 predicted 912
10 SASI_Rn02_00201757 predicted 608
11 SASI_Rn01_00122192 predicted 320
12 SASI_Rn01_00122193 predicted 402
13 SASI_Rn01_00122195 predicted 275
14 SASI_Rn01_00122196 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322524 predicted 1056
2 SASI_Mm02_00322525 predicted 612
3 SASI_Mm02_00322526 predicted 1114
4 SASI_Mm02_00322527 predicted 687
5 SASI_Mm02_00322528 predicted 1474
6 SASI_Mm02_00322529 predicted 1243
7 SASI_Mm02_00322530 predicted 397
8 SASI_Mm02_00322531 predicted 658
9 SASI_Mm02_00322532 predicted 446
10 SASI_Mm02_00322533 predicted 1403
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003113
VALIDATED
SP100 MISSION shRNA Bacterial Glycerol Stock
SP100 nuclear antigen
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003113.3-2980s21c1
Sequence:CCGGACCTTTGCCTGGTACAGTATGCTCGAGCATACTGTACCAGGCAAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003113.3-3040s21c1
Sequence:CCGGGTTAGTGCACAGCACAAATTACTCGAGTAATTTGTGCTGTGCACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003113.3-2115s21c1
Sequence:CCGGTATACGCTGCGGTGGATATACCTCGAGGTATATCCACCGCAGCGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003113.3-2226s21c1
Sequence:CCGGTGACCCTTGTGAGGAGCATAACTCGAGTTATGCTCCTCACAAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003113.3-381s21c1
Sequence:CCGGTCGTGATCTCATCACAAATAACTCGAGTTATTTGTGATGAGATCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003113.3-1210s21c1
Sequence:CCGGGACAACCCTTTAGAATCAAATCTCGAGATTTGATTCTAAAGGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003113.3-1748s21c1
Sequence:CCGGAGAGAAGGCATAGATCTAAAGCTCGAGCTTTAGATCTATGCCTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003113.3-1074s21c1
Sequence:CCGGCCAAGCAAGAACTCATCATAACTCGAGTTATGATGAGTTCTTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003113.3-1187s21c1
Sequence:CCGGGAAGTGAGCCTGTGATCAATACTCGAGTATTGATCACAGGCTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_003113.2-1760s1c1
Sequence:CCGGGCCAACACTAGACCTTTGAAACTCGAGTTTCAAAGGTCTAGTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_003113.2-714s1c1
Sequence:CCGGCGCTAGGAAGCCAACAAACAACTCGAGTTGTTTGTTGGCTTCCTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003113.2-1541s1c1
Sequence:CCGGGCAAGGACTGAAAGTAGTCAACTCGAGTTGACTACTTTCAGTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003113.2-1872s1c1
Sequence:CCGGGCACTCTATATAAGGAGCGATCTCGAGATCGCTCCTTATATAGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003113.2-92s1c1
Sequence:CCGGGCAAATGAGATGAACCATCTTCTCGAGAAGATGGTTCATCTCATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003113
VALIDATED
SP100 MISSION shRNA shRNA Plasmid DNA
SP100 nuclear antigen
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003113.3-2980s21c1
Sequence:CCGGACCTTTGCCTGGTACAGTATGCTCGAGCATACTGTACCAGGCAAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003113.3-3040s21c1
Sequence:CCGGGTTAGTGCACAGCACAAATTACTCGAGTAATTTGTGCTGTGCACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003113.3-2115s21c1
Sequence:CCGGTATACGCTGCGGTGGATATACCTCGAGGTATATCCACCGCAGCGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003113.3-2226s21c1
Sequence:CCGGTGACCCTTGTGAGGAGCATAACTCGAGTTATGCTCCTCACAAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003113.3-381s21c1
Sequence:CCGGTCGTGATCTCATCACAAATAACTCGAGTTATTTGTGATGAGATCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003113.3-1210s21c1
Sequence:CCGGGACAACCCTTTAGAATCAAATCTCGAGATTTGATTCTAAAGGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003113.3-1748s21c1
Sequence:CCGGAGAGAAGGCATAGATCTAAAGCTCGAGCTTTAGATCTATGCCTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003113.3-1074s21c1
Sequence:CCGGCCAAGCAAGAACTCATCATAACTCGAGTTATGATGAGTTCTTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003113.3-1187s21c1
Sequence:CCGGGAAGTGAGCCTGTGATCAATACTCGAGTATTGATCACAGGCTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_003113.2-1760s1c1
Sequence:CCGGGCCAACACTAGACCTTTGAAACTCGAGTTTCAAAGGTCTAGTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_003113.2-714s1c1
Sequence:CCGGCGCTAGGAAGCCAACAAACAACTCGAGTTGTTTGTTGGCTTCCTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003113.2-1541s1c1
Sequence:CCGGGCAAGGACTGAAAGTAGTCAACTCGAGTTGACTACTTTCAGTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003113.2-1872s1c1
Sequence:CCGGGCACTCTATATAAGGAGCGATCTCGAGATCGCTCCTTATATAGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003113.2-92s1c1
Sequence:CCGGGCAAATGAGATGAACCATCTTCTCGAGAAGATGGTTCATCTCATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003113
VALIDATED
SP100 MISSION shRNA Lentiviral Transduction Particles
SP100 nuclear antigen
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003113.3-2980s21c1
Sequence:CCGGACCTTTGCCTGGTACAGTATGCTCGAGCATACTGTACCAGGCAAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003113.3-3040s21c1
Sequence:CCGGGTTAGTGCACAGCACAAATTACTCGAGTAATTTGTGCTGTGCACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003113.3-2115s21c1
Sequence:CCGGTATACGCTGCGGTGGATATACCTCGAGGTATATCCACCGCAGCGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003113.3-2226s21c1
Sequence:CCGGTGACCCTTGTGAGGAGCATAACTCGAGTTATGCTCCTCACAAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003113.3-381s21c1
Sequence:CCGGTCGTGATCTCATCACAAATAACTCGAGTTATTTGTGATGAGATCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003113.3-1210s21c1
Sequence:CCGGGACAACCCTTTAGAATCAAATCTCGAGATTTGATTCTAAAGGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003113.3-1748s21c1
Sequence:CCGGAGAGAAGGCATAGATCTAAAGCTCGAGCTTTAGATCTATGCCTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003113.3-1074s21c1
Sequence:CCGGCCAAGCAAGAACTCATCATAACTCGAGTTATGATGAGTTCTTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003113.3-1187s21c1
Sequence:CCGGGAAGTGAGCCTGTGATCAATACTCGAGTATTGATCACAGGCTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_003113.2-1760s1c1
Sequence:CCGGGCCAACACTAGACCTTTGAAACTCGAGTTTCAAAGGTCTAGTGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_003113.2-714s1c1
Sequence:CCGGCGCTAGGAAGCCAACAAACAACTCGAGTTGTTTGTTGGCTTCCTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003113.2-1541s1c1
Sequence:CCGGGCAAGGACTGAAAGTAGTCAACTCGAGTTGACTACTTTCAGTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003113.2-1872s1c1
Sequence:CCGGGCACTCTATATAAGGAGCGATCTCGAGATCGCTCCTTATATAGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003113.2-92s1c1
Sequence:CCGGGCAAATGAGATGAACCATCTTCTCGAGAAGATGGTTCATCTCATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013673
SP100 MISSION shRNA Bacterial Glycerol Stock
SP100 nuclear antigen
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013673.3-843s21c1
Sequence:GTACCGGATGAGGACTCTGAGATAATAGCTCGAGCTATTATCTCAGAGTCCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013673.3-1920s21c1
Sequence:CCGGTCCCGTCTCTAACCTTCTATACTCGAGTATAGAAGGTTAGAGACGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013673.3-1582s21c1
Sequence:CCGGCCGGGAGCACATGTGGTTAAACTCGAGTTTAACCACATGTGCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013673.3-1054s21c1
Sequence:CCGGGAGACTTGGAAGCTACTTAATCTCGAGATTAAGTAGCTTCCAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013673.3-999s21c1
Sequence:CCGGCTGAGAGCTCTATCATCATTACTCGAGTAATGATGATAGAGCTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013673.1-523s1c1
Sequence:CCGGGTGCCAGCTATTCTCAAGGAACTCGAGTTCCTTGAGAATAGCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013673.1-450s1c1
Sequence:CCGGCCCAATGAATTGTGTTTCCAACTCGAGTTGGAAACACAATTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013673.1-583s1c1
Sequence:CCGGGCTGGAGAAGTAATGATAGAACTCGAGTTCTATCATTACTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013673.1-193s1c1
Sequence:CCGGCCATTTCTAATGCGATAAGAACTCGAGTTCTTATCGCATTAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013673.1-1433s1c1
Sequence:CCGGCCTGAGAGAACTGATACAGAACTCGAGTTCTGTATCAGTTCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013673
SP100 MISSION shRNA shRNA Plasmid DNA
SP100 nuclear antigen
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013673.3-843s21c1
Sequence:GTACCGGATGAGGACTCTGAGATAATAGCTCGAGCTATTATCTCAGAGTCCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013673.3-1920s21c1
Sequence:CCGGTCCCGTCTCTAACCTTCTATACTCGAGTATAGAAGGTTAGAGACGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013673.3-1582s21c1
Sequence:CCGGCCGGGAGCACATGTGGTTAAACTCGAGTTTAACCACATGTGCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013673.3-1054s21c1
Sequence:CCGGGAGACTTGGAAGCTACTTAATCTCGAGATTAAGTAGCTTCCAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013673.3-999s21c1
Sequence:CCGGCTGAGAGCTCTATCATCATTACTCGAGTAATGATGATAGAGCTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013673.1-523s1c1
Sequence:CCGGGTGCCAGCTATTCTCAAGGAACTCGAGTTCCTTGAGAATAGCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013673.1-450s1c1
Sequence:CCGGCCCAATGAATTGTGTTTCCAACTCGAGTTGGAAACACAATTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013673.1-583s1c1
Sequence:CCGGGCTGGAGAAGTAATGATAGAACTCGAGTTCTATCATTACTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013673.1-193s1c1
Sequence:CCGGCCATTTCTAATGCGATAAGAACTCGAGTTCTTATCGCATTAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013673.1-1433s1c1
Sequence:CCGGCCTGAGAGAACTGATACAGAACTCGAGTTCTGTATCAGTTCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013673
SP100 MISSION shRNA Lentiviral Transduction Particles
SP100 nuclear antigen
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013673.3-843s21c1
Sequence:GTACCGGATGAGGACTCTGAGATAATAGCTCGAGCTATTATCTCAGAGTCCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013673.3-1920s21c1
Sequence:CCGGTCCCGTCTCTAACCTTCTATACTCGAGTATAGAAGGTTAGAGACGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013673.3-1582s21c1
Sequence:CCGGCCGGGAGCACATGTGGTTAAACTCGAGTTTAACCACATGTGCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013673.3-1054s21c1
Sequence:CCGGGAGACTTGGAAGCTACTTAATCTCGAGATTAAGTAGCTTCCAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013673.3-999s21c1
Sequence:CCGGCTGAGAGCTCTATCATCATTACTCGAGTAATGATGATAGAGCTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013673.1-523s1c1
Sequence:CCGGGTGCCAGCTATTCTCAAGGAACTCGAGTTCCTTGAGAATAGCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013673.1-450s1c1
Sequence:CCGGCCCAATGAATTGTGTTTCCAACTCGAGTTGGAAACACAATTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013673.1-583s1c1
Sequence:CCGGGCTGGAGAAGTAATGATAGAACTCGAGTTCTATCATTACTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013673.1-193s1c1
Sequence:CCGGCCATTTCTAATGCGATAAGAACTCGAGTTCTTATCGCATTAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013673.1-1433s1c1
Sequence:CCGGCCTGAGAGAACTGATACAGAACTCGAGTTCTGTATCAGTTCTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks