EMAIL THIS PAGE TO A FRIEND

SP110

SP110 nuclear body protein

Synonyms: IFI41 IFI75 IPR1 VODI
Gene ID:
Human(3431) Summary: The nuclear body is a multiprotein complex that may have a role in the regulation of gene transcription. This gene is a member of the SP100/SP140 family of nuclear body proteins and encodes a leukocyte-specific nuclear body component. The protein can function as an activator of gene transcription and may serve as a nuclear hormone receptor coactivator. In addition, it has been suggested that the protein may play a role in ribosome biogenesis and in the induction of myeloid cell differentiation. Alternative splicing has been observed for this gene and three transcript variants, encoding distinct isoforms, have been identified. [provided by RefSeq, Jul 2008]
Mouse(109032) Sp110 nuclear body protein
Rat(301570) SP110 nuclear body protein
dog(100686387) SP110 nuclear body protein
domestic cat(101093454) SP110 nuclear body protein
Horse(100056977) SP110 nuclear body protein
cow(515204) SP110 nuclear body protein
naked mole-rat(101722876) SP110 nuclear body protein
domestic guinea pig(101787198) SP110 nuclear body protein
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS4407 Anti-IPR1 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS4409 Anti-IPR1 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, western blot pricing
SAB1100226 Anti-SP110 (251-265) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2102270 Anti-SP110 (ab1) antibody produced in rabbit affinity isolated antibody human, canine
western blot pricing
SAB2102271 Anti-SP110 (ab2) antibody produced in rabbit affinity isolated antibody human, horse
western blot pricing
SAB1405990 Anti-SP110 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2104307 Anti-SP110 antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA047036 Anti-SP110 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA058554 Anti-SP110 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
WH0003431M1 Monoclonal Anti-SP110 antibody produced in mouse clone 8C8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1403961 Monoclonal Anti-SP110 antibody produced in mouse clone 6F11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175397 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175397 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175397 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004509 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004509 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004509 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004509 Rosetta Predictions human pricing
NM_004510 Rosetta Predictions human pricing
NM_080424 Rosetta Predictions human pricing
NM_001034137 Rosetta Predictions rat pricing
NM_175397 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167323 predicted 375
2 SASI_Hs01_00167324 predicted 323
3 SASI_Hs01_00167325 predicted 255
4 SASI_Hs01_00167327 predicted 301
5 SASI_Hs02_00337779 predicted 207
6 SASI_Hs01_00167328 predicted 574
7 SASI_Hs01_00167329 predicted 281
8 SASI_Hs01_00167330 predicted 543
9 SASI_Hs01_00167331 predicted 443
10 SASI_Hs01_00167332 predicted 357
11 SASI_Hs01_00167326 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031908 predicted 379
2 SASI_Hs01_00031909 predicted 331
3 SASI_Hs01_00031910 predicted 257
4 SASI_Hs01_00031912 predicted 298
5 SASI_Hs02_00337780 predicted 206
6 SASI_Hs01_00031913 predicted 570
7 SASI_Hs01_00031914 predicted 279
8 SASI_Hs01_00031915 predicted 537
9 SASI_Hs01_00031916 predicted 442
10 SASI_Hs01_00031917 predicted 354
11 SASI_Hs01_00031911 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217999 predicted 380
2 SASI_Hs01_00218000 predicted 327
3 SASI_Hs01_00218001 predicted 258
4 SASI_Hs01_00218003 predicted 304
5 SASI_Hs02_00362266 predicted 205
6 SASI_Hs01_00218004 predicted 574
7 SASI_Hs01_00218005 predicted 285
8 SASI_Hs01_00218006 predicted 535
9 SASI_Hs01_00218007 predicted 444
10 SASI_Hs01_00218008 predicted 358
11 SASI_Hs01_00218002 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087132 predicted 335
2 SASI_Rn01_00087133 predicted 534
3 SASI_Rn02_00203987 predicted 1212
4 SASI_Rn01_00087134 predicted 1378
5 SASI_Rn01_00087135 predicted 356
6 SASI_Rn01_00087136 predicted 213
7 SASI_Rn01_00087137 predicted 282
8 SASI_Rn01_00087139 predicted 1280
9 SASI_Rn01_00087140 predicted 591
10 SASI_Rn02_00203988 predicted 1442
11 SASI_Rn01_00087131 predicted 419
12 SASI_Rn01_00087138 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081310 predicted 447
2 SASI_Mm01_00081312 predicted 518
3 SASI_Mm01_00081313 predicted 389
4 SASI_Mm01_00081315 predicted 585
5 SASI_Mm01_00081316 predicted 441
6 SASI_Mm01_00081318 predicted 506
7 SASI_Mm01_00081319 predicted 331
8 SASI_Mm02_00346247 predicted 389
9 SASI_Mm02_00346248 predicted 387
10 SASI_Mm02_00346249 predicted 277
11 SASI_Mm01_00081311 predicted 738
12 SASI_Mm01_00081314 predicted 676
13 SASI_Mm01_00081317 predicted 369
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175397
SP110 MISSION shRNA Bacterial Glycerol Stock
SP110 nuclear body protein
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194101    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175397.3-1530s1c1
Sequence:CCGGGATGAACTCCTGACCTGATATCTCGAGATATCAGGTCAGGAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175397.3-1067s1c1
Sequence:CCGGCTTTGTGGAAAGATGACTCATCTCGAGATGAGTCATCTTTCCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175397.3-679s1c1
Sequence:CCGGCCAATCATTGAGATCCTGGATCTCGAGATCCAGGATCTCAATGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175397.3-217s1c1
Sequence:CCGGGCTCTTCTCCAGCATTTCATACTCGAGTATGAAATGCTGGAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175397.3-1528s1c1
Sequence:CCGGCAGATGAACTCCTGACCTGATCTCGAGATCAGGTCAGGAGTTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175397.3-1241s1c1
Sequence:CCGGCCAAGAATGACGCTGTGGATTCTCGAGAATCCACAGCGTCATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175397.3-1485s1c1
Sequence:CCGGGTTCTGTATCTCCAAGAGTAACTCGAGTTACTCTTGGAGATACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175397.4-691s21c1
Sequence:CCGGCAACCGCACAGCCAATCATTGCTCGAGCAATGATTGGCTGTGCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175397.4-1550s21c1
Sequence:CCGGGATGAACTCCTGACCTGATATCTCGAGATATCAGGTCAGGAGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175397.4-513s21c1
Sequence:GTACCGGAGCTTCAGAAACGTTGGTTATCTCGAGATAACCAACGTTTCTGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175397.4-962s21c1
Sequence:CCGGACGTCCGAACTGGTCAAATTCCTCGAGGAATTTGACCAGTTCGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175397.4-467s21c1
Sequence:CCGGCAAGGTCAACCTCCGGGAATACTCGAGTATTCCCGGAGGTTGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175397
SP110 MISSION shRNA shRNA Plasmid DNA
SP110 nuclear body protein
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194101    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175397.3-1530s1c1
Sequence:CCGGGATGAACTCCTGACCTGATATCTCGAGATATCAGGTCAGGAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175397.3-1067s1c1
Sequence:CCGGCTTTGTGGAAAGATGACTCATCTCGAGATGAGTCATCTTTCCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175397.3-679s1c1
Sequence:CCGGCCAATCATTGAGATCCTGGATCTCGAGATCCAGGATCTCAATGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175397.3-217s1c1
Sequence:CCGGGCTCTTCTCCAGCATTTCATACTCGAGTATGAAATGCTGGAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175397.3-1528s1c1
Sequence:CCGGCAGATGAACTCCTGACCTGATCTCGAGATCAGGTCAGGAGTTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175397.3-1241s1c1
Sequence:CCGGCCAAGAATGACGCTGTGGATTCTCGAGAATCCACAGCGTCATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175397.3-1485s1c1
Sequence:CCGGGTTCTGTATCTCCAAGAGTAACTCGAGTTACTCTTGGAGATACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175397.4-691s21c1
Sequence:CCGGCAACCGCACAGCCAATCATTGCTCGAGCAATGATTGGCTGTGCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175397.4-1550s21c1
Sequence:CCGGGATGAACTCCTGACCTGATATCTCGAGATATCAGGTCAGGAGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175397.4-513s21c1
Sequence:GTACCGGAGCTTCAGAAACGTTGGTTATCTCGAGATAACCAACGTTTCTGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175397.4-962s21c1
Sequence:CCGGACGTCCGAACTGGTCAAATTCCTCGAGGAATTTGACCAGTTCGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175397.4-467s21c1
Sequence:CCGGCAAGGTCAACCTCCGGGAATACTCGAGTATTCCCGGAGGTTGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175397
SP110 MISSION shRNA Lentiviral Transduction Particles
SP110 nuclear body protein
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194101    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175397.3-1530s1c1
Sequence:CCGGGATGAACTCCTGACCTGATATCTCGAGATATCAGGTCAGGAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175397.3-1067s1c1
Sequence:CCGGCTTTGTGGAAAGATGACTCATCTCGAGATGAGTCATCTTTCCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175397.3-679s1c1
Sequence:CCGGCCAATCATTGAGATCCTGGATCTCGAGATCCAGGATCTCAATGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175397.3-217s1c1
Sequence:CCGGGCTCTTCTCCAGCATTTCATACTCGAGTATGAAATGCTGGAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175397.3-1528s1c1
Sequence:CCGGCAGATGAACTCCTGACCTGATCTCGAGATCAGGTCAGGAGTTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175397.3-1241s1c1
Sequence:CCGGCCAAGAATGACGCTGTGGATTCTCGAGAATCCACAGCGTCATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175397.3-1485s1c1
Sequence:CCGGGTTCTGTATCTCCAAGAGTAACTCGAGTTACTCTTGGAGATACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175397.4-691s21c1
Sequence:CCGGCAACCGCACAGCCAATCATTGCTCGAGCAATGATTGGCTGTGCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175397.4-1550s21c1
Sequence:CCGGGATGAACTCCTGACCTGATATCTCGAGATATCAGGTCAGGAGTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175397.4-513s21c1
Sequence:GTACCGGAGCTTCAGAAACGTTGGTTATCTCGAGATAACCAACGTTTCTGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175397.4-962s21c1
Sequence:CCGGACGTCCGAACTGGTCAAATTCCTCGAGGAATTTGACCAGTTCGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175397.4-467s21c1
Sequence:CCGGCAAGGTCAACCTCCGGGAATACTCGAGTATTCCCGGAGGTTGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004509
VALIDATED
SP110 MISSION shRNA Bacterial Glycerol Stock
SP110 nuclear body protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_004509.2-870s1c1
Sequence:CCGGCCAGAACCAAATGACCCAGAACTCGAGTTCTGGGTCATTTGGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004509.2-209s1c1
Sequence:CCGGCCTCCTAGACAACTCCATCATCTCGAGATGATGGAGTTGTCTAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004509.2-1631s1c1
Sequence:CCGGCGCAAAGAACTGGAAACGGAACTCGAGTTCCGTTTCCAGTTCTTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004509.2-2023s1c1
Sequence:CCGGGCCTGATGTTTCGCAACCATACTCGAGTATGGTTGCGAAACATCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_004509.2-332s1c1
Sequence:CCGGCCTGTCTCTTCTGGTGACATTCTCGAGAATGTCACCAGAAGAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004509.3-2089s21c1
Sequence:CCGGATGTGGTTGGACCTGGTTAAGCTCGAGCTTAACCAGGTCCAACCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004509.3-2222s21c1
Sequence:CCGGTTGACTTAGAGGCAGAATTTGCTCGAGCAAATTCTGCCTCTAAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004509.3-498s21c1
Sequence:CCGGTCAAATTAACCTGCGTGAATACTCGAGTATTCACGCAGGTTAATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004509.3-520s21c1
Sequence:CCGGCCCAATCTGGTGACGATTTACCTCGAGGTAAATCGTCACCAGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004509
VALIDATED
SP110 MISSION shRNA shRNA Plasmid DNA
SP110 nuclear body protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_004509.2-870s1c1
Sequence:CCGGCCAGAACCAAATGACCCAGAACTCGAGTTCTGGGTCATTTGGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004509.2-209s1c1
Sequence:CCGGCCTCCTAGACAACTCCATCATCTCGAGATGATGGAGTTGTCTAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004509.2-1631s1c1
Sequence:CCGGCGCAAAGAACTGGAAACGGAACTCGAGTTCCGTTTCCAGTTCTTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004509.2-2023s1c1
Sequence:CCGGGCCTGATGTTTCGCAACCATACTCGAGTATGGTTGCGAAACATCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_004509.2-332s1c1
Sequence:CCGGCCTGTCTCTTCTGGTGACATTCTCGAGAATGTCACCAGAAGAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004509.3-2089s21c1
Sequence:CCGGATGTGGTTGGACCTGGTTAAGCTCGAGCTTAACCAGGTCCAACCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004509.3-2222s21c1
Sequence:CCGGTTGACTTAGAGGCAGAATTTGCTCGAGCAAATTCTGCCTCTAAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004509.3-498s21c1
Sequence:CCGGTCAAATTAACCTGCGTGAATACTCGAGTATTCACGCAGGTTAATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004509.3-520s21c1
Sequence:CCGGCCCAATCTGGTGACGATTTACCTCGAGGTAAATCGTCACCAGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004509
VALIDATED
SP110 MISSION shRNA Lentiviral Transduction Particles
SP110 nuclear body protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_004509.2-870s1c1
Sequence:CCGGCCAGAACCAAATGACCCAGAACTCGAGTTCTGGGTCATTTGGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004509.2-209s1c1
Sequence:CCGGCCTCCTAGACAACTCCATCATCTCGAGATGATGGAGTTGTCTAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004509.2-1631s1c1
Sequence:CCGGCGCAAAGAACTGGAAACGGAACTCGAGTTCCGTTTCCAGTTCTTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_004509.2-2023s1c1
Sequence:CCGGGCCTGATGTTTCGCAACCATACTCGAGTATGGTTGCGAAACATCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_004509.2-332s1c1
Sequence:CCGGCCTGTCTCTTCTGGTGACATTCTCGAGAATGTCACCAGAAGAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004509.3-2089s21c1
Sequence:CCGGATGTGGTTGGACCTGGTTAAGCTCGAGCTTAACCAGGTCCAACCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004509.3-2222s21c1
Sequence:CCGGTTGACTTAGAGGCAGAATTTGCTCGAGCAAATTCTGCCTCTAAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004509.3-498s21c1
Sequence:CCGGTCAAATTAACCTGCGTGAATACTCGAGTATTCACGCAGGTTAATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004509.3-520s21c1
Sequence:CCGGCCCAATCTGGTGACGATTTACCTCGAGGTAAATCGTCACCAGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks