EMAIL THIS PAGE TO A FRIEND

SP140

SP140 nuclear body protein

Synonyms: LYSP100 LYSP100-A LYSP100-B
Gene ID:
Mouse(434484) Sp140 nuclear body protein
Rat(316580) SP140 nuclear body protein
Horse(100063568) SP140 nuclear body protein
domestic cat(101093705) SP140 nuclear body protein
dog(609988) SP140 nuclear body protein
domestic guinea pig(100727974) SP140 nuclear body protein
naked mole-rat(101725789) SP140 nuclear body protein
cow(510377) SP140 nuclear body protein
sheep(101120733) SP140 nuclear body protein
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007237 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007237 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007237 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013817 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013817 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013817 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005176 Rosetta Predictions human pricing
NM_007237 Rosetta Predictions human pricing
NM_001012133 Rosetta Predictions rat pricing
XM_576602 Rosetta Predictions rat pricing
NM_001013817 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061452 predicted 221
2 SASI_Hs01_00061453 predicted 287
3 SASI_Hs01_00061454 predicted 216
4 SASI_Hs01_00061455 predicted 287
5 SASI_Hs01_00061456 predicted 273
6 SASI_Hs01_00061457 predicted 289
7 SASI_Hs01_00061458 predicted 218
8 SASI_Hs01_00061459 predicted 266
9 SASI_Hs01_00061460 predicted 221
10 SASI_Hs01_00061461 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007237 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183602 predicted 214
2 SASI_Hs01_00183603 predicted 285
3 SASI_Hs01_00183604 predicted 213
4 SASI_Hs01_00183605 predicted 278
5 SASI_Hs01_00183606 predicted 273
6 SASI_Hs01_00183607 predicted 289
7 SASI_Hs01_00183608 predicted 217
8 SASI_Hs01_00183609 predicted 266
9 SASI_Hs01_00183610 predicted 217
10 SASI_Hs01_00183611 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082095 predicted 1315
2 SASI_Rn02_00200300 predicted 2518
3 SASI_Rn01_00082096 predicted 668
4 SASI_Rn01_00082097 predicted 2501
5 SASI_Rn02_00200301 predicted 1614
6 SASI_Rn02_00200302 predicted 528
7 SASI_Rn01_00082098 predicted 1857
8 SASI_Rn01_00082099 predicted 1454
9 SASI_Rn01_00082100 predicted 620
10 SASI_Rn01_00082102 predicted 2329
11 SASI_Rn01_00082101 predicted 2499
12 SASI_Rn01_00082103 predicted 796
13 SASI_Rn01_00082104 predicted 2560
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00131897 predicted 2524
2 SASI_Rn01_00131898 predicted 2509
3 SASI_Rn01_00131899 predicted 540
4 SASI_Rn01_00131900 predicted 529
5 SASI_Rn01_00131901 predicted 2490
6 SASI_Rn01_00131902 predicted 2334
7 SASI_Rn01_00131903 predicted 2455
8 SASI_Rn01_00131904 predicted 2551
9 SASI_Rn01_00131905 predicted 2196
10 SASI_Rn01_00131906 predicted 2366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013817 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120140 predicted 2030
2 SASI_Mm01_00120141 predicted 2032
3 SASI_Mm01_00120142 predicted 2145
4 SASI_Mm01_00120143 predicted 2154
5 SASI_Mm01_00120144 predicted 1952
6 SASI_Mm01_00120145 predicted 809
7 SASI_Mm01_00120146 predicted 1674
8 SASI_Mm01_00120147 predicted 1299
9 SASI_Mm01_00120148 predicted 1847
10 SASI_Mm01_00120149 predicted 1766
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007237
SP140 MISSION shRNA Bacterial Glycerol Stock
SP140 nuclear body protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007237.4-1415s21c1
Sequence:CCGGTCTAGCCTGCTATATGATAATCTCGAGATTATCATATAGCAGGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007237.4-1279s21c1
Sequence:CCGGCAGTGATGACTGTTCGGAAATCTCGAGATTTCCGAACAGTCATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007237.4-483s21c1
Sequence:CCGGATCCTGATTTAAACGAGATTTCTCGAGAAATCTCGTTTAAATCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007237.4-575s21c1
Sequence:CCGGAGACCCAGATTACTACCATATCTCGAGATATGGTAGTAATCTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007237.2-831s1c1
Sequence:CCGGCCCAAGTTACTGCCTTATGATCTCGAGATCATAAGGCAGTAACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007237.2-383s1c1
Sequence:CCGGCCCAGTGACAAGAGTGATGTACTCGAGTACATCACTCTTGTCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007237.2-540s1c1
Sequence:CCGGCCTCTCCAAATGAATAATGTACTCGAGTACATTATTCATTTGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007237.2-1447s1c1
Sequence:CCGGCGGAGCAATCAGCATATGAAACTCGAGTTTCATATGCTGATTGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007237.2-1934s1c1
Sequence:CCGGGCAGCAAGGAATCTTGGTGAACTCGAGTTCACCAAGATTCCTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007237
SP140 MISSION shRNA shRNA Plasmid DNA
SP140 nuclear body protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007237.4-1415s21c1
Sequence:CCGGTCTAGCCTGCTATATGATAATCTCGAGATTATCATATAGCAGGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007237.4-1279s21c1
Sequence:CCGGCAGTGATGACTGTTCGGAAATCTCGAGATTTCCGAACAGTCATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007237.4-483s21c1
Sequence:CCGGATCCTGATTTAAACGAGATTTCTCGAGAAATCTCGTTTAAATCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007237.4-575s21c1
Sequence:CCGGAGACCCAGATTACTACCATATCTCGAGATATGGTAGTAATCTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007237.2-831s1c1
Sequence:CCGGCCCAAGTTACTGCCTTATGATCTCGAGATCATAAGGCAGTAACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007237.2-383s1c1
Sequence:CCGGCCCAGTGACAAGAGTGATGTACTCGAGTACATCACTCTTGTCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007237.2-540s1c1
Sequence:CCGGCCTCTCCAAATGAATAATGTACTCGAGTACATTATTCATTTGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007237.2-1447s1c1
Sequence:CCGGCGGAGCAATCAGCATATGAAACTCGAGTTTCATATGCTGATTGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007237.2-1934s1c1
Sequence:CCGGGCAGCAAGGAATCTTGGTGAACTCGAGTTCACCAAGATTCCTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007237
SP140 MISSION shRNA Lentiviral Transduction Particles
SP140 nuclear body protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007237.4-1415s21c1
Sequence:CCGGTCTAGCCTGCTATATGATAATCTCGAGATTATCATATAGCAGGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007237.4-1279s21c1
Sequence:CCGGCAGTGATGACTGTTCGGAAATCTCGAGATTTCCGAACAGTCATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007237.4-483s21c1
Sequence:CCGGATCCTGATTTAAACGAGATTTCTCGAGAAATCTCGTTTAAATCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007237.4-575s21c1
Sequence:CCGGAGACCCAGATTACTACCATATCTCGAGATATGGTAGTAATCTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007237.2-831s1c1
Sequence:CCGGCCCAAGTTACTGCCTTATGATCTCGAGATCATAAGGCAGTAACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007237.2-383s1c1
Sequence:CCGGCCCAGTGACAAGAGTGATGTACTCGAGTACATCACTCTTGTCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007237.2-540s1c1
Sequence:CCGGCCTCTCCAAATGAATAATGTACTCGAGTACATTATTCATTTGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007237.2-1447s1c1
Sequence:CCGGCGGAGCAATCAGCATATGAAACTCGAGTTTCATATGCTGATTGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007237.2-1934s1c1
Sequence:CCGGGCAGCAAGGAATCTTGGTGAACTCGAGTTCACCAAGATTCCTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013817
SP140 MISSION shRNA Bacterial Glycerol Stock
SP140 nuclear body protein
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013817.2-1325s21c1
Sequence:CCGGTGGTTCACACCCTCGGAATTTCTCGAGAAATTCCGAGGGTGTGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013817.2-1386s21c1
Sequence:CCGGTGAGCCTGCGCTGCCATAATTCTCGAGAATTATGGCAGCGCAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013817.2-2153s21c1
Sequence:CCGGGATGATTACTCTTGGTCATATCTCGAGATATGACCAAGAGTAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013817.2-1518s21c1
Sequence:CCGGGTATTCAGAACTCAGATAAATCTCGAGATTTATCTGAGTTCTGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013817.2-1964s21c1
Sequence:CCGGGACCCTAAGTTTGGCGAAATGCTCGAGCATTTCGCCAAACTTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013817.1-2112s1c1
Sequence:CCGGGCAGCAGCAATGAGTGTTCTTCTCGAGAAGAACACTCATTGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013817.1-1750s1c1
Sequence:CCGGGTATGTTCTCTTGAGAGTCTACTCGAGTAGACTCTCAAGAGAACATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013817
SP140 MISSION shRNA shRNA Plasmid DNA
SP140 nuclear body protein
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013817.2-1325s21c1
Sequence:CCGGTGGTTCACACCCTCGGAATTTCTCGAGAAATTCCGAGGGTGTGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013817.2-1386s21c1
Sequence:CCGGTGAGCCTGCGCTGCCATAATTCTCGAGAATTATGGCAGCGCAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013817.2-2153s21c1
Sequence:CCGGGATGATTACTCTTGGTCATATCTCGAGATATGACCAAGAGTAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013817.2-1518s21c1
Sequence:CCGGGTATTCAGAACTCAGATAAATCTCGAGATTTATCTGAGTTCTGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013817.2-1964s21c1
Sequence:CCGGGACCCTAAGTTTGGCGAAATGCTCGAGCATTTCGCCAAACTTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013817.1-2112s1c1
Sequence:CCGGGCAGCAGCAATGAGTGTTCTTCTCGAGAAGAACACTCATTGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013817.1-1750s1c1
Sequence:CCGGGTATGTTCTCTTGAGAGTCTACTCGAGTAGACTCTCAAGAGAACATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013817
SP140 MISSION shRNA Lentiviral Transduction Particles
SP140 nuclear body protein
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013817.2-1325s21c1
Sequence:CCGGTGGTTCACACCCTCGGAATTTCTCGAGAAATTCCGAGGGTGTGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013817.2-1386s21c1
Sequence:CCGGTGAGCCTGCGCTGCCATAATTCTCGAGAATTATGGCAGCGCAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013817.2-2153s21c1
Sequence:CCGGGATGATTACTCTTGGTCATATCTCGAGATATGACCAAGAGTAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013817.2-1518s21c1
Sequence:CCGGGTATTCAGAACTCAGATAAATCTCGAGATTTATCTGAGTTCTGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013817.2-1964s21c1
Sequence:CCGGGACCCTAAGTTTGGCGAAATGCTCGAGCATTTCGCCAAACTTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201712    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013817.1-2112s1c1
Sequence:CCGGGCAGCAGCAATGAGTGTTCTTCTCGAGAAGAACACTCATTGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013817.1-1750s1c1
Sequence:CCGGGTATGTTCTCTTGAGAGTCTACTCGAGTAGACTCTCAAGAGAACATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks