EMAIL THIS PAGE TO A FRIEND

SP140L

SP140 nuclear body protein-like

UniProtKB ID: Q9H930, Q2M375, Q4ZG65, Q9BSP3
Gene ID:
cow(100139208) SP140 nuclear body protein-like
sheep(101121244) SP140 nuclear body protein-like
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138402 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138402 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138402 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138402 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158774 predicted 587
2 SASI_Hs01_00158775 predicted 1044
3 SASI_Hs01_00158776 predicted 568
4 SASI_Hs01_00158777 predicted 1201
5 SASI_Hs02_00363545 predicted 221
6 SASI_Hs01_00158779 predicted 583
7 SASI_Hs01_00158780 predicted 1218
8 SASI_Hs01_00158782 predicted 591
9 SASI_Hs02_00363546 predicted 131
10 SASI_Hs02_00363547 predicted 1752
11 SASI_Hs01_00158778 predicted 312
12 SASI_Hs01_00158781 predicted 341
13 SASI_Hs01_00158783 predicted 1383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138402
VALIDATED
SP140L MISSION shRNA Bacterial Glycerol Stock
SP140 nuclear body protein-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138402.2-600s1c1
Sequence:CCGGGATCTCTACCTAATCCTCCAACTCGAGTTGGAGGATTAGGTAGAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138402.2-347s1c1
Sequence:CCGGGCTTCAAGAAAGCACAAAGATCTCGAGATCTTTGTGCTTTCTTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138402.2-456s1c1
Sequence:CCGGCCTTGGCAAAGTGTATACAGACTCGAGTCTGTATACACTTTGCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138402.2-742s1c1
Sequence:CCGGCGACACTTGTTCAAGAGTCTTCTCGAGAAGACTCTTGAACAAGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138402.2-591s1c1
Sequence:CCGGTGGAGGAAGGATCTCTACCTACTCGAGTAGGTAGAGATCCTTCCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138402.4-1210s21c1
Sequence:CCGGACCTAATCCTCCAAGAATATACTCGAGTATATTCTTGGAGGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138402.4-137s21c1
Sequence:CCGGGGTGTTTCACAAGTAGCAAATCTCGAGATTTGCTACTTGTGAAACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138402.4-589s21c1
Sequence:CCGGTGACATCAAACTAAGTCTTAACTCGAGTTAAGACTTAGTTTGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138402.4-269s21c1
Sequence:CCGGCATAAGCTGGAGATATCAAATCTCGAGATTTGATATCTCCAGCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138402
VALIDATED
SP140L MISSION shRNA shRNA Plasmid DNA
SP140 nuclear body protein-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138402.2-600s1c1
Sequence:CCGGGATCTCTACCTAATCCTCCAACTCGAGTTGGAGGATTAGGTAGAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138402.2-347s1c1
Sequence:CCGGGCTTCAAGAAAGCACAAAGATCTCGAGATCTTTGTGCTTTCTTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138402.2-456s1c1
Sequence:CCGGCCTTGGCAAAGTGTATACAGACTCGAGTCTGTATACACTTTGCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138402.2-742s1c1
Sequence:CCGGCGACACTTGTTCAAGAGTCTTCTCGAGAAGACTCTTGAACAAGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138402.2-591s1c1
Sequence:CCGGTGGAGGAAGGATCTCTACCTACTCGAGTAGGTAGAGATCCTTCCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138402.4-1210s21c1
Sequence:CCGGACCTAATCCTCCAAGAATATACTCGAGTATATTCTTGGAGGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138402.4-137s21c1
Sequence:CCGGGGTGTTTCACAAGTAGCAAATCTCGAGATTTGCTACTTGTGAAACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138402.4-589s21c1
Sequence:CCGGTGACATCAAACTAAGTCTTAACTCGAGTTAAGACTTAGTTTGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138402.4-269s21c1
Sequence:CCGGCATAAGCTGGAGATATCAAATCTCGAGATTTGATATCTCCAGCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138402
VALIDATED
SP140L MISSION shRNA Lentiviral Transduction Particles
SP140 nuclear body protein-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138402.2-600s1c1
Sequence:CCGGGATCTCTACCTAATCCTCCAACTCGAGTTGGAGGATTAGGTAGAGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138402.2-347s1c1
Sequence:CCGGGCTTCAAGAAAGCACAAAGATCTCGAGATCTTTGTGCTTTCTTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138402.2-456s1c1
Sequence:CCGGCCTTGGCAAAGTGTATACAGACTCGAGTCTGTATACACTTTGCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138402.2-742s1c1
Sequence:CCGGCGACACTTGTTCAAGAGTCTTCTCGAGAAGACTCTTGAACAAGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138402.2-591s1c1
Sequence:CCGGTGGAGGAAGGATCTCTACCTACTCGAGTAGGTAGAGATCCTTCCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138402.4-1210s21c1
Sequence:CCGGACCTAATCCTCCAAGAATATACTCGAGTATATTCTTGGAGGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_138402.4-137s21c1
Sequence:CCGGGGTGTTTCACAAGTAGCAAATCTCGAGATTTGCTACTTGTGAAACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138402.4-589s21c1
Sequence:CCGGTGACATCAAACTAAGTCTTAACTCGAGTTAAGACTTAGTTTGATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138402.4-269s21c1
Sequence:CCGGCATAAGCTGGAGATATCAAATCTCGAGATTTGATATCTCCAGCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks