EMAIL THIS PAGE TO A FRIEND

SP1

Sp1 transcription factor

UniProtKB ID: P08047, Q86TN8, Q9H3Q5, Q9NR51, Q9NY21, Q9NYE7
Gene ID:
Human(6667) Summary: The protein encoded by this gene is a zinc finger transcription factor that binds to GC-rich motifs of many promoters. The encoded protein is involved in many cellular processes, including cell differentiation, cell growth, apoptosis, immune responses, response to DNA damage, and chromatin remodeling. Post-translational modifications such as phosphorylation, acetylation, glycosylation, and proteolytic processing significantly affect the activity of this protein, which can be an activator or a repressor. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(20683) trans-acting transcription factor 1
Rat(24790) Sp1 transcription factor
cow(540741) Sp1 transcription factor
sheep(100303456) Sp1 transcription factor
Goat(100860911) Sp1 transcription factor
sheep(101104139) Sp1 transcription factor
Domestic Rabbit(100351317) Sp1 transcription factor
naked mole-rat(101697506) Sp1 transcription factor
domestic guinea pig(100726500) Sp1 transcription factor
fruit fly(31913) CG1343 gene product from transcript CG1343-RE
Zebrafish(324109) sp1 transcription factor
dog(486507) Sp1 transcription factor
domestic cat(101100227) Sp1 transcription factor
chicken(395303) Sp1 transcription factor
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503992 Anti-phospho-SP1 (pThr453) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300670 Anti-phospho-SP1 (pThr739) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4504535 Anti-phospho-SP1 (pThr739) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
AV37192 Anti-SP1 (AB1) antibody produced in rabbit IgG fraction of antiserum rat, guinea pig, bovine, mouse, human, rabbit
western blot pricing
AV37193 Anti-SP1 (AB2) antibody produced in rabbit IgG fraction of antiserum horse, pig, mouse, rabbit, rat
western blot pricing
SAB2500981 Anti-SP1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1412220 ANTI-SP1 antibody produced in mouse clone 4H6, purified immunoglobulin, buffered aqueous solution , human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412261 ANTI-SP1 antibody produced in mouse clone 4B11, purified immunoglobulin, buffered aqueous solution , human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412262 ANTI-SP1 antibody produced in mouse clone 2G5, purified immunoglobulin, buffered aqueous solution , human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412263 ANTI-SP1 antibody produced in mouse clone 3H7, purified immunoglobulin, buffered aqueous solution , human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412264 ANTI-SP1 antibody produced in mouse clone 1G9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
S9809 Anti-Sp1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
microarray, western blot pricing
HPA001853 Anti-SP1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV43585 Anti-SP1 antibody produced in rabbit affinity isolated antibody human, rat, guinea pig, bovine, mouse, rabbit
western blot pricing
HPA012292 Anti-SP1 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4502836 Anti-SP1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4502837 Anti-SP1, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
PLA0307 Goat anti-Sp1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, mouse
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing
WH0006667M2 Monoclonal Anti-SP1 antibody produced in mouse clone 1A5, purified immunoglobulin, buffered aqueous solution mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404397 Monoclonal Anti-SP1 antibody produced in mouse clone 4C8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PLA0044 Rabbit anti-Sp1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. pig, chicken, dog, toad, toad, goat, bovine, horse, rabbit, primate, human, mouse
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013672 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013672 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013672 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138473 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138473 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138473 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138473 Rosetta Predictions human pricing
NM_012655 Rosetta Predictions rat pricing
NM_013672 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363664 predicted 1077
2 SASI_Hs01_00070994 predicted 709
3 SASI_Hs01_00070995 predicted 2204
4 SASI_Hs01_00070996 predicted 1096
5 SASI_Hs01_00070997 predicted 1680
6 SASI_Hs01_00070998 predicted 756
7 SASI_Hs01_00071000 predicted 703
8 SASI_Hs01_00071001 predicted 1637
9 SASI_Hs01_00071002 predicted 2076
10 SASI_Hs02_00363665 predicted 1208
11 SASI_Hs01_00070993 predicted 1101
12 SASI_Hs01_00070999 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012655 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038010 predicted 701
2 SASI_Rn01_00038011 predicted 1033
3 SASI_Rn01_00038012 predicted 655
4 SASI_Rn01_00038014 predicted 1624
5 SASI_Rn02_00259908 predicted 2258
6 SASI_Rn01_00038015 predicted 1224
7 SASI_Rn01_00038017 predicted 1519
8 SASI_Rn01_00038018 predicted 1022
9 SASI_Rn02_00259909 predicted 2304
10 SASI_Rn01_00038019 predicted 2021
11 SASI_Rn01_00038013 predicted 1132
12 SASI_Rn01_00038016 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145222 predicted 759
2 SASI_Mm01_00145223 predicted 1975
3 SASI_Mm02_00322522 predicted 1125
4 SASI_Mm01_00145224 predicted 1567
5 SASI_Mm01_00145225 predicted 1959
6 SASI_Mm01_00145226 predicted 1096
7 SASI_Mm02_00322523 predicted 1061
8 SASI_Mm01_00145227 predicted 1073
9 SASI_Mm01_00145228 predicted 1687
10 SASI_Mm01_00145231 predicted 2072
11 SASI_Mm01_00145229 predicted 2314
12 SASI_Mm01_00145230 predicted 1274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013672
VALIDATED
SP1 MISSION shRNA Bacterial Glycerol Stock
Sp1 transcription factor
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013672.1-1581s1c1
Sequence:CCGGGCAGCAGTAATACCACCCTAACTCGAGTTAGGGTGGTATTACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013672.1-551s1c1
Sequence:CCGGCCCAACTTACAGAACCAGCAACTCGAGTTGCTGGTTCTGTAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013672.1-685s1c1
Sequence:CCGGGCAGGATGGTTCTGGTCAAATCTCGAGATTTGACCAGAACCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013672.1-1059s1c1
Sequence:CCGGCCAATGCCAATAGTTATTCAACTCGAGTTGAATAACTATTGGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013672.1-1365s1c1
Sequence:CCGGCCTTCACAACTCAAGCTATTTCTCGAGAAATAGCTTGAGTTGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013672.2-2346s21c1
Sequence:CCGGCCATCTGTCCAGAGGGTATTGCTCGAGCAATACCCTCTGGACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013672.2-5957s21c1
Sequence:CCGGTATGGGATGAAGGTGTTATAACTCGAGTTATAACACCTTCATCCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013672.2-2302s21c1
Sequence:CCGGCACTCCTTCAGCCCTTATTACCTCGAGGTAATAAGGGCTGAAGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013672.2-2061s21c1
Sequence:CCGGTCATGTGTAATTGGTCATATTCTCGAGAATATGACCAATTACACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013672.2-589s21c1
Sequence:CCGGCCCTGGAGTAATGCCTAATATCTCGAGATATTAGGCATTACTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013672.2-729s21c1
Sequence:CCGGACCAACAGATCATCCCAAATACTCGAGTATTTGGGATGATCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013672.2-2535s21c1
Sequence:CCGGAGAGAGCCATGAGGCATTAATCTCGAGATTAATGCCTCATGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013672.2-2106s21c1
Sequence:CCGGACGAGCTTCAGAGACATAAACCTCGAGGTTTATGTCTCTGAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013672.2-2792s21c1
Sequence:CCGGAGCCATCATGCCTTGATAAATCTCGAGATTTATCAAGGCATGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013672
VALIDATED
SP1 MISSION shRNA shRNA Plasmid DNA
Sp1 transcription factor
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013672.1-1581s1c1
Sequence:CCGGGCAGCAGTAATACCACCCTAACTCGAGTTAGGGTGGTATTACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013672.1-551s1c1
Sequence:CCGGCCCAACTTACAGAACCAGCAACTCGAGTTGCTGGTTCTGTAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013672.1-685s1c1
Sequence:CCGGGCAGGATGGTTCTGGTCAAATCTCGAGATTTGACCAGAACCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013672.1-1059s1c1
Sequence:CCGGCCAATGCCAATAGTTATTCAACTCGAGTTGAATAACTATTGGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013672.1-1365s1c1
Sequence:CCGGCCTTCACAACTCAAGCTATTTCTCGAGAAATAGCTTGAGTTGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013672.2-2346s21c1
Sequence:CCGGCCATCTGTCCAGAGGGTATTGCTCGAGCAATACCCTCTGGACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013672.2-5957s21c1
Sequence:CCGGTATGGGATGAAGGTGTTATAACTCGAGTTATAACACCTTCATCCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013672.2-2302s21c1
Sequence:CCGGCACTCCTTCAGCCCTTATTACCTCGAGGTAATAAGGGCTGAAGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013672.2-2061s21c1
Sequence:CCGGTCATGTGTAATTGGTCATATTCTCGAGAATATGACCAATTACACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013672.2-589s21c1
Sequence:CCGGCCCTGGAGTAATGCCTAATATCTCGAGATATTAGGCATTACTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013672.2-729s21c1
Sequence:CCGGACCAACAGATCATCCCAAATACTCGAGTATTTGGGATGATCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013672.2-2535s21c1
Sequence:CCGGAGAGAGCCATGAGGCATTAATCTCGAGATTAATGCCTCATGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013672.2-2106s21c1
Sequence:CCGGACGAGCTTCAGAGACATAAACCTCGAGGTTTATGTCTCTGAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013672.2-2792s21c1
Sequence:CCGGAGCCATCATGCCTTGATAAATCTCGAGATTTATCAAGGCATGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013672
VALIDATED
SP1 MISSION shRNA Lentiviral Transduction Particles
Sp1 transcription factor
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013672.1-1581s1c1
Sequence:CCGGGCAGCAGTAATACCACCCTAACTCGAGTTAGGGTGGTATTACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013672.1-551s1c1
Sequence:CCGGCCCAACTTACAGAACCAGCAACTCGAGTTGCTGGTTCTGTAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013672.1-685s1c1
Sequence:CCGGGCAGGATGGTTCTGGTCAAATCTCGAGATTTGACCAGAACCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013672.1-1059s1c1
Sequence:CCGGCCAATGCCAATAGTTATTCAACTCGAGTTGAATAACTATTGGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013672.1-1365s1c1
Sequence:CCGGCCTTCACAACTCAAGCTATTTCTCGAGAAATAGCTTGAGTTGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013672.2-2346s21c1
Sequence:CCGGCCATCTGTCCAGAGGGTATTGCTCGAGCAATACCCTCTGGACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013672.2-5957s21c1
Sequence:CCGGTATGGGATGAAGGTGTTATAACTCGAGTTATAACACCTTCATCCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013672.2-2302s21c1
Sequence:CCGGCACTCCTTCAGCCCTTATTACCTCGAGGTAATAAGGGCTGAAGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013672.2-2061s21c1
Sequence:CCGGTCATGTGTAATTGGTCATATTCTCGAGAATATGACCAATTACACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013672.2-589s21c1
Sequence:CCGGCCCTGGAGTAATGCCTAATATCTCGAGATATTAGGCATTACTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013672.2-729s21c1
Sequence:CCGGACCAACAGATCATCCCAAATACTCGAGTATTTGGGATGATCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013672.2-2535s21c1
Sequence:CCGGAGAGAGCCATGAGGCATTAATCTCGAGATTAATGCCTCATGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013672.2-2106s21c1
Sequence:CCGGACGAGCTTCAGAGACATAAACCTCGAGGTTTATGTCTCTGAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013672.2-2792s21c1
Sequence:CCGGAGCCATCATGCCTTGATAAATCTCGAGATTTATCAAGGCATGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138473
VALIDATED
SP1 MISSION shRNA Bacterial Glycerol Stock
Sp1 transcription factor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138473.2-290s1c1
Sequence:CCGGGCAGCAACTTGCAGCAGAATTCTCGAGAATTCTGCTGCAAGTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138473.2-719s1c1
Sequence:CCGGCCAGGTGCAAACCAACAGATTCTCGAGAATCTGTTGGTTTGCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138473.2-2310s1c1
Sequence:CCGGCCACTCCTTCAGCCCTTATTACTCGAGTAATAAGGGCTGAAGGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_138473.2-1805s1c1
Sequence:CCGGGCTGGTGGTGATGGAATACATCTCGAGATGTATTCCATCACCACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138473.2-1805s21c1
Sequence:CCGGGCTGGTGGTGATGGAATACATCTCGAGATGTATTCCATCACCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138473.2-2413s21c1
Sequence:CCGGGGCAGATCTGCAGTCCATTAACTCGAGTTAATGGACTGCAGATCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138473.2-589s21c1
Sequence:CCGGACCTGGAGTGATGCCTAATATCTCGAGATATTAGGCATCACTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138473.2-809s21c1
Sequence:CCGGCTCCAAGGCCTGGCTAATAATCTCGAGATTATTAGCCAGGCCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138473
VALIDATED
SP1 MISSION shRNA shRNA Plasmid DNA
Sp1 transcription factor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138473.2-290s1c1
Sequence:CCGGGCAGCAACTTGCAGCAGAATTCTCGAGAATTCTGCTGCAAGTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138473.2-719s1c1
Sequence:CCGGCCAGGTGCAAACCAACAGATTCTCGAGAATCTGTTGGTTTGCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138473.2-2310s1c1
Sequence:CCGGCCACTCCTTCAGCCCTTATTACTCGAGTAATAAGGGCTGAAGGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_138473.2-1805s1c1
Sequence:CCGGGCTGGTGGTGATGGAATACATCTCGAGATGTATTCCATCACCACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138473.2-1805s21c1
Sequence:CCGGGCTGGTGGTGATGGAATACATCTCGAGATGTATTCCATCACCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138473.2-2413s21c1
Sequence:CCGGGGCAGATCTGCAGTCCATTAACTCGAGTTAATGGACTGCAGATCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138473.2-589s21c1
Sequence:CCGGACCTGGAGTGATGCCTAATATCTCGAGATATTAGGCATCACTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138473.2-809s21c1
Sequence:CCGGCTCCAAGGCCTGGCTAATAATCTCGAGATTATTAGCCAGGCCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138473
VALIDATED
SP1 MISSION shRNA Lentiviral Transduction Particles
Sp1 transcription factor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138473.2-290s1c1
Sequence:CCGGGCAGCAACTTGCAGCAGAATTCTCGAGAATTCTGCTGCAAGTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138473.2-719s1c1
Sequence:CCGGCCAGGTGCAAACCAACAGATTCTCGAGAATCTGTTGGTTTGCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138473.2-2310s1c1
Sequence:CCGGCCACTCCTTCAGCCCTTATTACTCGAGTAATAAGGGCTGAAGGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_138473.2-1805s1c1
Sequence:CCGGGCTGGTGGTGATGGAATACATCTCGAGATGTATTCCATCACCACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138473.2-1805s21c1
Sequence:CCGGGCTGGTGGTGATGGAATACATCTCGAGATGTATTCCATCACCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138473.2-2413s21c1
Sequence:CCGGGGCAGATCTGCAGTCCATTAACTCGAGTTAATGGACTGCAGATCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138473.2-589s21c1
Sequence:CCGGACCTGGAGTGATGCCTAATATCTCGAGATATTAGGCATCACTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138473.2-809s21c1
Sequence:CCGGCTCCAAGGCCTGGCTAATAATCTCGAGATTATTAGCCAGGCCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks