EMAIL THIS PAGE TO A FRIEND

SP2

Sp2 transcription factor

UniProtKB ID: Q02086, A6NK74
Gene ID:
Human(6668) Summary: This gene encodes a member of the Sp subfamily of Sp/XKLF transcription factors. Sp family proteins are sequence-specific DNA-binding proteins characterized by an amino-terminal trans-activation domain and three carboxy-terminal zinc finger motifs. This protein contains the least conserved DNA-binding domain within the Sp subfamily of proteins, and its DNA sequence specificity differs from the other Sp proteins. It localizes primarily within subnuclear foci associated with the nuclear matrix, and can activate or in some cases repress expression from different promoters. [provided by RefSeq, Jul 2008]
Mouse(78912) Sp2 transcription factor
Rat(303499) Sp2 transcription factor
Zebrafish(556835) sp2 transcription factor
dog(100687491) Sp2 transcription factor
Horse(100069204) Sp2 transcription factor
domestic cat(101085252) Sp2 transcription factor
chicken(425673) Sp2 transcription factor
cow(534403) Sp2 transcription factor
sheep(101117430) Sp2 transcription factor
naked mole-rat(101706695) Sp2 transcription factor
domestic guinea pig(100721317) Sp2 transcription factor
126 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003110 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003110 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003110 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030220 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030220 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030220 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003110 Rosetta Predictions human pricing
NM_001107045 Rosetta Predictions rat pricing
NM_001080964 Rosetta Predictions mouse pricing
NM_030220 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058711 predicted 325
2 SASI_Hs01_00058712 predicted 329
3 SASI_Hs01_00058713 predicted 510
4 SASI_Hs01_00058714 predicted 1443
5 SASI_Hs01_00058716 predicted 849
6 SASI_Hs01_00058715 predicted 1793
7 SASI_Hs01_00058717 predicted 1965
8 SASI_Hs01_00058718 predicted 573
9 SASI_Hs01_00058720 predicted 602
10 SASI_Hs02_00335076 predicted 540
11 SASI_Hs01_00058719 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107045 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224946 predicted 895
2 SASI_Rn02_00224947 predicted 2009
3 SASI_Rn02_00224948 predicted 2016
4 SASI_Rn02_00224949 predicted 1555
5 SASI_Rn02_00224950 predicted 1092
6 SASI_Rn02_00224951 predicted 1298
7 SASI_Rn02_00224952 predicted 1999
8 SASI_Rn02_00224953 predicted 1425
9 SASI_Rn02_00224954 predicted 1313
10 SASI_Rn02_00224955 predicted 1304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080964 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294143 predicted 1804
2 SASI_Mm02_00294144 predicted 774
3 SASI_Mm02_00294145 predicted 1746
4 SASI_Mm02_00294146 predicted 1763
5 SASI_Mm02_00294147 predicted 1185
6 SASI_Mm02_00294148 predicted 1113
7 SASI_Mm02_00294149 predicted 1709
8 SASI_Mm02_00294150 predicted 1362
9 SASI_Mm02_00294151 predicted 426
10 SASI_Mm02_00294152 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030220 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069326 predicted 1805
2 SASI_Mm01_00069328 predicted 770
3 SASI_Mm01_00069330 predicted 1746
4 SASI_Mm02_00336649 predicted 309
5 SASI_Mm01_00069331 predicted 1761
6 SASI_Mm01_00069332 predicted 297
7 SASI_Mm01_00069333 predicted 1716
8 SASI_Mm01_00069334 predicted 1367
9 SASI_Mm02_00336650 predicted 433
10 SASI_Mm02_00336651 predicted 303
11 SASI_Mm01_00069325 predicted 471
12 SASI_Mm01_00069327 predicted 1330
13 SASI_Mm01_00069329 predicted 1121
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003110
VALIDATED
SP2 MISSION shRNA Bacterial Glycerol Stock
Sp2 transcription factor
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003110.5-1144s21c1
Sequence:CCGGAGAAGCCCTCCCAGAACTTTCCTCGAGGAAAGTTCTGGGAGGGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003110.5-507s21c1
Sequence:CCGGACCCGATCAAATGCCAATATCCTCGAGGATATTGGCATTTGATCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003110.5-545s21c1
Sequence:CCGGTCAGATTCAGGCAAGCAATTCCTCGAGGAATTGCTTGCCTGAATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003110.5-856s21c1
Sequence:CCGGTGTCTAAGACTAACAAGAAAGCTCGAGCTTTCTTGTTAGTCTTAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003110.5-466s21c1
Sequence:CCGGTGGTGTTCGCTATCCAGAATCCTCGAGGATTCTGGATAGCGAACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003110.5-2248s21c1
Sequence:CCGGGACGCGTGGGAACCCTTATTTCTCGAGAAATAAGGGTTCCCACGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003110.5-1740s21c1
Sequence:CCGGACGTTCCGTAAGACGTCCTTGCTCGAGCAAGGACGTCTTACGGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003110.5-779s21c1
Sequence:CCGGGCCCGTCAACAACCTTGTGAACTCGAGTTCACAAGGTTGTTGACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_003110.4-1406s1c1
Sequence:CCGGGCAGAATGTTTCTGGGAACAACTCGAGTTGTTCCCAGAAACATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_003110.4-2524s1c1
Sequence:CCGGCCCTTCTTCCTTTCCTTGTTACTCGAGTAACAAGGAAAGGAAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003110.4-728s1c1
Sequence:CCGGCCCACTGTCTAAGACTAACAACTCGAGTTGTTAGTCTTAGACAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003110.4-852s1c1
Sequence:CCGGGCAGGAAATAACCTGCTCATTCTCGAGAATGAGCAGGTTATTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003110.4-251s1c1
Sequence:CCGGCGGCAAGAATAGCTTTGGAATCTCGAGATTCCAAAGCTATTCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003110
VALIDATED
SP2 MISSION shRNA shRNA Plasmid DNA
Sp2 transcription factor
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003110.5-1144s21c1
Sequence:CCGGAGAAGCCCTCCCAGAACTTTCCTCGAGGAAAGTTCTGGGAGGGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003110.5-507s21c1
Sequence:CCGGACCCGATCAAATGCCAATATCCTCGAGGATATTGGCATTTGATCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003110.5-545s21c1
Sequence:CCGGTCAGATTCAGGCAAGCAATTCCTCGAGGAATTGCTTGCCTGAATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003110.5-856s21c1
Sequence:CCGGTGTCTAAGACTAACAAGAAAGCTCGAGCTTTCTTGTTAGTCTTAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003110.5-466s21c1
Sequence:CCGGTGGTGTTCGCTATCCAGAATCCTCGAGGATTCTGGATAGCGAACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003110.5-2248s21c1
Sequence:CCGGGACGCGTGGGAACCCTTATTTCTCGAGAAATAAGGGTTCCCACGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003110.5-1740s21c1
Sequence:CCGGACGTTCCGTAAGACGTCCTTGCTCGAGCAAGGACGTCTTACGGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003110.5-779s21c1
Sequence:CCGGGCCCGTCAACAACCTTGTGAACTCGAGTTCACAAGGTTGTTGACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_003110.4-1406s1c1
Sequence:CCGGGCAGAATGTTTCTGGGAACAACTCGAGTTGTTCCCAGAAACATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_003110.4-2524s1c1
Sequence:CCGGCCCTTCTTCCTTTCCTTGTTACTCGAGTAACAAGGAAAGGAAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003110.4-728s1c1
Sequence:CCGGCCCACTGTCTAAGACTAACAACTCGAGTTGTTAGTCTTAGACAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003110.4-852s1c1
Sequence:CCGGGCAGGAAATAACCTGCTCATTCTCGAGAATGAGCAGGTTATTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003110.4-251s1c1
Sequence:CCGGCGGCAAGAATAGCTTTGGAATCTCGAGATTCCAAAGCTATTCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003110
VALIDATED
SP2 MISSION shRNA Lentiviral Transduction Particles
Sp2 transcription factor
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003110.5-1144s21c1
Sequence:CCGGAGAAGCCCTCCCAGAACTTTCCTCGAGGAAAGTTCTGGGAGGGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003110.5-507s21c1
Sequence:CCGGACCCGATCAAATGCCAATATCCTCGAGGATATTGGCATTTGATCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003110.5-545s21c1
Sequence:CCGGTCAGATTCAGGCAAGCAATTCCTCGAGGAATTGCTTGCCTGAATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003110.5-856s21c1
Sequence:CCGGTGTCTAAGACTAACAAGAAAGCTCGAGCTTTCTTGTTAGTCTTAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003110.5-466s21c1
Sequence:CCGGTGGTGTTCGCTATCCAGAATCCTCGAGGATTCTGGATAGCGAACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003110.5-2248s21c1
Sequence:CCGGGACGCGTGGGAACCCTTATTTCTCGAGAAATAAGGGTTCCCACGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003110.5-1740s21c1
Sequence:CCGGACGTTCCGTAAGACGTCCTTGCTCGAGCAAGGACGTCTTACGGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003110.5-779s21c1
Sequence:CCGGGCCCGTCAACAACCTTGTGAACTCGAGTTCACAAGGTTGTTGACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_003110.4-1406s1c1
Sequence:CCGGGCAGAATGTTTCTGGGAACAACTCGAGTTGTTCCCAGAAACATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_003110.4-2524s1c1
Sequence:CCGGCCCTTCTTCCTTTCCTTGTTACTCGAGTAACAAGGAAAGGAAGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003110.4-728s1c1
Sequence:CCGGCCCACTGTCTAAGACTAACAACTCGAGTTGTTAGTCTTAGACAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003110.4-852s1c1
Sequence:CCGGGCAGGAAATAACCTGCTCATTCTCGAGAATGAGCAGGTTATTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003110.4-251s1c1
Sequence:CCGGCGGCAAGAATAGCTTTGGAATCTCGAGATTCCAAAGCTATTCTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030220
VALIDATED
SP2 MISSION shRNA Bacterial Glycerol Stock
Sp2 transcription factor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030220.3-565s21c1
Sequence:CCGGCCCGTCAACATCTGGTCATAACTCGAGTTATGACCAGATGTTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030220.3-1453s21c1
Sequence:CCGGGCAGAACGTTTCTGGAAACAACTCGAGTTGTTTCCAGAAACGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030220.3-1106s21c1
Sequence:CCGGCCAACACCAACCCAGGTTTATCTCGAGATAAACCTGGGTTGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304610    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030220.3-2130s21c1
Sequence:CCGGTGCCCAATGAGACGTTCTAACCTCGAGGTTAGAACGTCTCATTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030220.3-1825s21c1
Sequence:CCGGCCAATGTCAGAAGCGCTTCATCTCGAGATGAAGCGCTTCTGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030220.2-1666s1c1
Sequence:CCGGGCAGAACGTTTCTGGAAACAACTCGAGTTGTTTCCAGAAACGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030220.2-1319s1c1
Sequence:CCGGCCAACACCAACCCAGGTTTATCTCGAGATAAACCTGGGTTGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030220.2-2038s1c1
Sequence:CCGGCCAATGTCAGAAGCGCTTCATCTCGAGATGAAGCGCTTCTGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030220.2-778s1c1
Sequence:CCGGCCCGTCAACATCTGGTCATAACTCGAGTTATGACCAGATGTTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030220.2-531s1c1
Sequence:CCGGGCATCTTATCATCTAAAGGAACTCGAGTTCCTTTAGATGATAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030220
VALIDATED
SP2 MISSION shRNA shRNA Plasmid DNA
Sp2 transcription factor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030220.3-565s21c1
Sequence:CCGGCCCGTCAACATCTGGTCATAACTCGAGTTATGACCAGATGTTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030220.3-1453s21c1
Sequence:CCGGGCAGAACGTTTCTGGAAACAACTCGAGTTGTTTCCAGAAACGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030220.3-1106s21c1
Sequence:CCGGCCAACACCAACCCAGGTTTATCTCGAGATAAACCTGGGTTGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304610    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030220.3-2130s21c1
Sequence:CCGGTGCCCAATGAGACGTTCTAACCTCGAGGTTAGAACGTCTCATTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030220.3-1825s21c1
Sequence:CCGGCCAATGTCAGAAGCGCTTCATCTCGAGATGAAGCGCTTCTGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030220.2-1666s1c1
Sequence:CCGGGCAGAACGTTTCTGGAAACAACTCGAGTTGTTTCCAGAAACGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030220.2-1319s1c1
Sequence:CCGGCCAACACCAACCCAGGTTTATCTCGAGATAAACCTGGGTTGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030220.2-2038s1c1
Sequence:CCGGCCAATGTCAGAAGCGCTTCATCTCGAGATGAAGCGCTTCTGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030220.2-778s1c1
Sequence:CCGGCCCGTCAACATCTGGTCATAACTCGAGTTATGACCAGATGTTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030220.2-531s1c1
Sequence:CCGGGCATCTTATCATCTAAAGGAACTCGAGTTCCTTTAGATGATAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030220
VALIDATED
SP2 MISSION shRNA Lentiviral Transduction Particles
Sp2 transcription factor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030220.3-565s21c1
Sequence:CCGGCCCGTCAACATCTGGTCATAACTCGAGTTATGACCAGATGTTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030220.3-1453s21c1
Sequence:CCGGGCAGAACGTTTCTGGAAACAACTCGAGTTGTTTCCAGAAACGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030220.3-1106s21c1
Sequence:CCGGCCAACACCAACCCAGGTTTATCTCGAGATAAACCTGGGTTGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304610    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030220.3-2130s21c1
Sequence:CCGGTGCCCAATGAGACGTTCTAACCTCGAGGTTAGAACGTCTCATTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030220.3-1825s21c1
Sequence:CCGGCCAATGTCAGAAGCGCTTCATCTCGAGATGAAGCGCTTCTGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030220.2-1666s1c1
Sequence:CCGGGCAGAACGTTTCTGGAAACAACTCGAGTTGTTTCCAGAAACGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030220.2-1319s1c1
Sequence:CCGGCCAACACCAACCCAGGTTTATCTCGAGATAAACCTGGGTTGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030220.2-2038s1c1
Sequence:CCGGCCAATGTCAGAAGCGCTTCATCTCGAGATGAAGCGCTTCTGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030220.2-778s1c1
Sequence:CCGGCCCGTCAACATCTGGTCATAACTCGAGTTATGACCAGATGTTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030220.2-531s1c1
Sequence:CCGGGCATCTTATCATCTAAAGGAACTCGAGTTCCTTTAGATGATAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks