EMAIL THIS PAGE TO A FRIEND

SP3

Sp3 transcription factor

Synonyms: SPR2
Gene ID:
Human(6670) Summary: This gene belongs to a family of Sp1 related genes that encode transcription factors that regulate transcription by binding to consensus GC- and GT-box regulatory elements in target genes. This protein contains a zinc finger DNA-binding domain and several transactivation domains, and has been reported to function as a bifunctional transcription factor that either stimulates or represses the transcription of numerous genes. Transcript variants encoding different isoforms have been described for this gene, and one has been reported to initiate translation from a non-AUG (AUA) start codon. Additional isoforms, resulting from the use of alternate downstream translation initiation sites, have also been noted. A related pseudogene has been identified on chromosome 13. [provided by RefSeq, Feb 2010]
Mouse(20687) trans-acting transcription factor 3
Rat(367846) Sp3 transcription factor
chicken(395302) Sp3 transcription factor
Horse(100064317) Sp3 transcription factor
domestic cat(101090127) Sp3 transcription factor
dog(488405) Sp3 transcription factor
domestic guinea pig(100729306) Sp3 transcription factor
cow(540766) Sp3 transcription factor
sheep(101106411) Sp3 transcription factor
sheep(100303457) Sp3 transcription factor
161 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001018042 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001018042 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001018042 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003111 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003111 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003111 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024031 MISSION® esiRNA esiRNA human SP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017371 Rosetta Predictions human pricing
NM_003111 Rosetta Predictions human pricing
NM_001029905 Rosetta Predictions rat pricing
NM_001018042 Rosetta Predictions mouse pricing
NM_001098425 Rosetta Predictions mouse pricing
NM_011450 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211941 predicted 1863
2 SASI_Hs01_00211942 predicted 1556
3 SASI_Hs01_00211943 predicted 1196
4 SASI_Hs01_00211944 predicted 1190
5 SASI_Hs01_00211945 predicted 2413
6 SASI_Hs01_00211946 predicted 847
7 SASI_Hs01_00211947 predicted 690
8 SASI_Hs01_00211948 predicted 1336
9 SASI_Hs01_00211949 predicted 1247
10 SASI_Hs01_00211950 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215617 predicted 1852
2 SASI_Hs01_00215618 predicted 1541
3 SASI_Hs01_00215619 predicted 1181
4 SASI_Hs01_00215620 predicted 1172
5 SASI_Hs01_00215621 predicted 2402
6 SASI_Hs01_00215622 predicted 835
7 SASI_Hs01_00215623 predicted 671
8 SASI_Hs01_00215624 predicted 1321
9 SASI_Hs01_00215625 predicted 1228
10 SASI_Hs01_00215626 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029905 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043594 predicted 845
2 SASI_Rn01_00043595 predicted 1733
3 SASI_Rn01_00043596 predicted 1578
4 SASI_Rn01_00043597 predicted 2351
5 SASI_Rn01_00043598 predicted 2070
6 SASI_Rn01_00043599 predicted 1094
7 SASI_Rn01_00043600 predicted 863
8 SASI_Rn01_00043601 predicted 1792
9 SASI_Rn01_00043602 predicted 1168
10 SASI_Rn01_00043603 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018042 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149247 predicted 1605
2 SASI_Mm02_00287545 predicted 684
3 SASI_Mm01_00149250 predicted 1899
4 SASI_Mm01_00149251 predicted 1422
5 SASI_Mm01_00149252 predicted 1902
6 SASI_Mm02_00287546 predicted 2596
7 SASI_Mm01_00149253 predicted 1010
8 SASI_Mm01_00149254 predicted 1711
9 SASI_Mm01_00149255 predicted 1213
10 SASI_Mm01_00149256 predicted 935
11 SASI_Mm01_00149248 predicted 708
12 SASI_Mm01_00149249 predicted 1574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098425 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301381 predicted 1515
2 SASI_Mm02_00301382 predicted 597
3 SASI_Mm02_00301383 predicted 1803
4 SASI_Mm02_00301384 predicted 1330
5 SASI_Mm02_00301385 predicted 1811
6 SASI_Mm02_00301386 predicted 2512
7 SASI_Mm02_00301387 predicted 915
8 SASI_Mm02_00301388 predicted 1618
9 SASI_Mm02_00301389 predicted 1117
10 SASI_Mm02_00301390 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011450 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075633 predicted 1261
2 SASI_Mm01_00075634 predicted 364
3 SASI_Mm01_00075635 predicted 1224
4 SASI_Mm01_00075636 predicted 1556
5 SASI_Mm01_00075637 predicted 1078
6 SASI_Mm01_00075638 predicted 1566
7 SASI_Mm01_00075639 predicted 660
8 SASI_Mm01_00075640 predicted 1359
9 SASI_Mm01_00075641 predicted 859
10 SASI_Mm01_00075642 predicted 596
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001018042
VALIDATED
SP3 MISSION shRNA Bacterial Glycerol Stock
Sp3 transcription factor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001018042.1-3889s1c1
Sequence:CCGGGCTACCTTATTGTACGTTTAACTCGAGTTAAACGTACAATAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001018042.1-2463s1c1
Sequence:CCGGCCAGCAATCAAGACATCCTTACTCGAGTAAGGATGTCTTGATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018042.1-818s1c1
Sequence:CCGGCCTGGCTCTAATCAAACCTTACTCGAGTAAGGTTTGATTAGAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018042.1-1925s1c1
Sequence:CCGGCGAGTACAAGTGGTAGATGAACTCGAGTTCATCTACCACTTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018042.1-2003s1c1
Sequence:CCGGCCCAACTGTAAAGAAGGTGGTCTCGAGACCACCTTCTTTACAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001018042.3-2866s21c1
Sequence:CCGGATGAGAAACTGTTGGTATTTACTCGAGTAAATACCAACAGTTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018042.3-914s21c1
Sequence:CCGGGCAATTGGTGGCTCATCATTTCTCGAGAAATGATGAGCCACCAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018042.3-1221s21c1
Sequence:CCGGCAATAGATAGTACAGGTATATCTCGAGATATACCTGTACTATCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018042.3-1049s21c1
Sequence:CCGGACAATGACTGCAGGCATTAATCTCGAGATTAATGCCTGCAGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001018042.3-987s21c1
Sequence:CCGGTTACCTTTGTACCAATCAATACTCGAGTATTGATTGGTACAAAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001018042
VALIDATED
SP3 MISSION shRNA shRNA Plasmid DNA
Sp3 transcription factor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001018042.1-3889s1c1
Sequence:CCGGGCTACCTTATTGTACGTTTAACTCGAGTTAAACGTACAATAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001018042.1-2463s1c1
Sequence:CCGGCCAGCAATCAAGACATCCTTACTCGAGTAAGGATGTCTTGATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018042.1-818s1c1
Sequence:CCGGCCTGGCTCTAATCAAACCTTACTCGAGTAAGGTTTGATTAGAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018042.1-1925s1c1
Sequence:CCGGCGAGTACAAGTGGTAGATGAACTCGAGTTCATCTACCACTTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018042.1-2003s1c1
Sequence:CCGGCCCAACTGTAAAGAAGGTGGTCTCGAGACCACCTTCTTTACAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001018042.3-2866s21c1
Sequence:CCGGATGAGAAACTGTTGGTATTTACTCGAGTAAATACCAACAGTTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018042.3-914s21c1
Sequence:CCGGGCAATTGGTGGCTCATCATTTCTCGAGAAATGATGAGCCACCAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018042.3-1221s21c1
Sequence:CCGGCAATAGATAGTACAGGTATATCTCGAGATATACCTGTACTATCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018042.3-1049s21c1
Sequence:CCGGACAATGACTGCAGGCATTAATCTCGAGATTAATGCCTGCAGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001018042.3-987s21c1
Sequence:CCGGTTACCTTTGTACCAATCAATACTCGAGTATTGATTGGTACAAAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001018042
VALIDATED
SP3 MISSION shRNA Lentiviral Transduction Particles
Sp3 transcription factor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001018042.1-3889s1c1
Sequence:CCGGGCTACCTTATTGTACGTTTAACTCGAGTTAAACGTACAATAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001018042.1-2463s1c1
Sequence:CCGGCCAGCAATCAAGACATCCTTACTCGAGTAAGGATGTCTTGATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018042.1-818s1c1
Sequence:CCGGCCTGGCTCTAATCAAACCTTACTCGAGTAAGGTTTGATTAGAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018042.1-1925s1c1
Sequence:CCGGCGAGTACAAGTGGTAGATGAACTCGAGTTCATCTACCACTTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018042.1-2003s1c1
Sequence:CCGGCCCAACTGTAAAGAAGGTGGTCTCGAGACCACCTTCTTTACAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001018042.3-2866s21c1
Sequence:CCGGATGAGAAACTGTTGGTATTTACTCGAGTAAATACCAACAGTTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018042.3-914s21c1
Sequence:CCGGGCAATTGGTGGCTCATCATTTCTCGAGAAATGATGAGCCACCAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018042.3-1221s21c1
Sequence:CCGGCAATAGATAGTACAGGTATATCTCGAGATATACCTGTACTATCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001018042.3-1049s21c1
Sequence:CCGGACAATGACTGCAGGCATTAATCTCGAGATTAATGCCTGCAGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001018042.3-987s21c1
Sequence:CCGGTTACCTTTGTACCAATCAATACTCGAGTATTGATTGGTACAAAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003111
VALIDATED
SP3 MISSION shRNA Bacterial Glycerol Stock
Sp3 transcription factor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003111.1-1392s1c1
Sequence:CCGGGCCCAAATTGTGCAAGGTATTCTCGAGAATACCTTGCACAATTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003111.1-3726s1c1
Sequence:CCGGGCTGGTCTTGTAAGAGCTATACTCGAGTATAGCTCTTACAAGACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003111.1-822s1c1
Sequence:CCGGCCTTCTGCTAACATCCAGAATCTCGAGATTCTGGATGTTAGCAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003111.1-2329s1c1
Sequence:CCGGCGCGAGATGATACTTTGATTACTCGAGTAATCAAAGTATCATCTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003111.1-1852s1c1
Sequence:CCGGGTGGTGATTCTACCTTGAATACTCGAGTATTCAAGGTAGAATCACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003111.3-3726s21c1
Sequence:CCGGGCTGGTCTTGTAAGAGCTATACTCGAGTATAGCTCTTACAAGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003111.3-822s21c1
Sequence:CCGGCCTTCTGCTAACATCCAGAATCTCGAGATTCTGGATGTTAGCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003111.3-2329s21c1
Sequence:CCGGCGCGAGATGATACTTTGATTACTCGAGTAATCAAAGTATCATCTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003111.3-1852s21c1
Sequence:CCGGGTGGTGATTCTACCTTGAATACTCGAGTATTCAAGGTAGAATCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003111.3-1017s21c1
Sequence:CCGGACAATGACTGCAGGCATTAATCTCGAGATTAATGCCTGCAGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003111
VALIDATED
SP3 MISSION shRNA shRNA Plasmid DNA
Sp3 transcription factor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003111.1-1392s1c1
Sequence:CCGGGCCCAAATTGTGCAAGGTATTCTCGAGAATACCTTGCACAATTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003111.1-3726s1c1
Sequence:CCGGGCTGGTCTTGTAAGAGCTATACTCGAGTATAGCTCTTACAAGACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003111.1-822s1c1
Sequence:CCGGCCTTCTGCTAACATCCAGAATCTCGAGATTCTGGATGTTAGCAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003111.1-2329s1c1
Sequence:CCGGCGCGAGATGATACTTTGATTACTCGAGTAATCAAAGTATCATCTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003111.1-1852s1c1
Sequence:CCGGGTGGTGATTCTACCTTGAATACTCGAGTATTCAAGGTAGAATCACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003111.3-3726s21c1
Sequence:CCGGGCTGGTCTTGTAAGAGCTATACTCGAGTATAGCTCTTACAAGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003111.3-822s21c1
Sequence:CCGGCCTTCTGCTAACATCCAGAATCTCGAGATTCTGGATGTTAGCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003111.3-2329s21c1
Sequence:CCGGCGCGAGATGATACTTTGATTACTCGAGTAATCAAAGTATCATCTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003111.3-1852s21c1
Sequence:CCGGGTGGTGATTCTACCTTGAATACTCGAGTATTCAAGGTAGAATCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003111.3-1017s21c1
Sequence:CCGGACAATGACTGCAGGCATTAATCTCGAGATTAATGCCTGCAGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003111
VALIDATED
SP3 MISSION shRNA Lentiviral Transduction Particles
Sp3 transcription factor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003111.1-1392s1c1
Sequence:CCGGGCCCAAATTGTGCAAGGTATTCTCGAGAATACCTTGCACAATTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003111.1-3726s1c1
Sequence:CCGGGCTGGTCTTGTAAGAGCTATACTCGAGTATAGCTCTTACAAGACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_003111.1-822s1c1
Sequence:CCGGCCTTCTGCTAACATCCAGAATCTCGAGATTCTGGATGTTAGCAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003111.1-2329s1c1
Sequence:CCGGCGCGAGATGATACTTTGATTACTCGAGTAATCAAAGTATCATCTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003111.1-1852s1c1
Sequence:CCGGGTGGTGATTCTACCTTGAATACTCGAGTATTCAAGGTAGAATCACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003111.3-3726s21c1
Sequence:CCGGGCTGGTCTTGTAAGAGCTATACTCGAGTATAGCTCTTACAAGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003111.3-822s21c1
Sequence:CCGGCCTTCTGCTAACATCCAGAATCTCGAGATTCTGGATGTTAGCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003111.3-2329s21c1
Sequence:CCGGCGCGAGATGATACTTTGATTACTCGAGTAATCAAAGTATCATCTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003111.3-1852s21c1
Sequence:CCGGGTGGTGATTCTACCTTGAATACTCGAGTATTCAAGGTAGAATCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003111.3-1017s21c1
Sequence:CCGGACAATGACTGCAGGCATTAATCTCGAGATTAATGCCTGCAGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks