EMAIL THIS PAGE TO A FRIEND

SP4

Sp4 transcription factor

Synonyms: HF1B SPR-1
UniProtKB ID: Q02446, O60402, Q32M52
Gene ID:
Mouse(20688) trans-acting transcription factor 4
Rat(25162) Sp4 transcription factor
Zebrafish(387291) sp4 transcription factor
domestic cat(101088230) Sp4 transcription factor
Horse(100053512) Sp4 transcription factor
dog(482345) Sp4 transcription factor
chicken(420607) Sp4 transcription factor
cow(523019) Sp4 transcription factor
sheep(101120237) Sp4 transcription factor
domestic guinea pig(100733971) Sp4 transcription factor
naked mole-rat(101704046) Sp4 transcription factor
185 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102274 Anti-SP4 antibody produced in rabbit affinity isolated antibody , rat, rabbit, human, mouse, guinea pig, horse
western blot pricing
HPA040395 Anti-SP4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003112 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009239 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009239 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009239 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003112 Rosetta Predictions human pricing
NM_012761 Rosetta Predictions rat pricing
XM_579348 Rosetta Predictions rat pricing
NM_009239 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114420 predicted 1061
2 SASI_Hs01_00114421 predicted 2551
3 SASI_Hs01_00114423 predicted 664
4 SASI_Hs02_00335077 predicted 1376
5 SASI_Hs01_00114424 predicted 721
6 SASI_Hs01_00114425 predicted 1538
7 SASI_Hs01_00114426 predicted 1586
8 SASI_Hs01_00114427 predicted 933
9 SASI_Hs01_00114428 predicted 1103
10 SASI_Hs02_00335078 predicted 2560
11 SASI_Hs01_00114419 predicted 1336
12 SASI_Hs01_00114422 predicted 2136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012761 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102786 predicted 1286
2 SASI_Rn01_00102787 predicted 670
3 SASI_Rn01_00102788 predicted 2508
4 SASI_Rn02_00260128 predicted 1853
5 SASI_Rn02_00260129 predicted 1645
6 SASI_Rn01_00102789 predicted 1031
7 SASI_Rn01_00102790 predicted 2563
8 SASI_Rn01_00102791 predicted 1542
9 SASI_Rn01_00102792 predicted 1495
10 SASI_Rn01_00102793 predicted 893
11 SASI_Rn01_00102794 predicted 347
12 SASI_Rn01_00102795 predicted 1342
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579348 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00141930 predicted 642
2 SASI_Rn01_00141931 predicted 1824
3 SASI_Rn01_00141932 predicted 643
4 SASI_Rn01_00141933 predicted 1890
5 SASI_Rn01_00141934 predicted 1004
6 SASI_Rn01_00141935 predicted 1080
7 SASI_Rn01_00141936 predicted 706
8 SASI_Rn01_00141937 predicted 863
9 SASI_Rn01_00141938 predicted 321
10 SASI_Rn01_00141939 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009239 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067676 predicted 1376
2 SASI_Mm01_00067677 predicted 2063
3 SASI_Mm01_00067678 predicted 2419
4 SASI_Mm01_00067679 predicted 1635
5 SASI_Mm01_00067680 predicted 1842
6 SASI_Mm01_00067682 predicted 1024
7 SASI_Mm01_00067683 predicted 1537
8 SASI_Mm01_00067684 predicted 884
9 SASI_Mm01_00067685 predicted 334
10 SASI_Mm02_00315714 predicted 1888
11 SASI_Mm01_00067681 predicted 2517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003112
VALIDATED
SP4 MISSION shRNA Bacterial Glycerol Stock
Sp4 transcription factor
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003112.3-1511s21c1
Sequence:CCGGGTTCAACTTCAAGCAGTAAATCTCGAGATTTACTGCTTGAAGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003112.3-1544s21c1
Sequence:CCGGCTTATCAGGGCTCCAACTTTACTCGAGTAAAGTTGGAGCCCTGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003112.3-2803s21c1
Sequence:CCGGGAATCTTCCCATCTCTTAATACTCGAGTATTAAGAGATGGGAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003112.3-2743s21c1
Sequence:CCGGGTATTTCCTCCATACTATAAGCTCGAGCTTATAGTATGGAGGAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003112.3-2050s21c1
Sequence:CCGGTGCCTGTTCCTGTCCTAATTGCTCGAGCAATTAGGACAGGAACAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003112.3-1157s21c1
Sequence:CCGGACCACTGCTTCAACGTCTTTGCTCGAGCAAAGACGTTGAAGCAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003112.3-860s21c1
Sequence:CCGGCAGACAGTTCCGGTCCAAATTCTCGAGAATTTGGACCGGAACTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003112.3-940s21c1
Sequence:CCGGTGTAACAACCCTACCAATTAACTCGAGTTAATTGGTAGGGTTGTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003112.3-1103s21c1
Sequence:CCGGACTACTTCTGCCAGTACTATGCTCGAGCATAGTACTGGCAGAAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_003112.2-2557s1c1
Sequence:CCGGCCTCTAGTGCTGCACTTGTTTCTCGAGAAACAAGTGCAGCACTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003112.2-1835s1c1
Sequence:CCGGCCCGTTACAATCACTAGTGTTCTCGAGAACACTAGTGATTGTAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003112.2-1420s1c1
Sequence:CCGGGCAACAGATCATTCAGGCTATCTCGAGATAGCCTGAATGATCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003112.2-567s1c1
Sequence:CCGGGCAGTAATAACGGGAGTGCATCTCGAGATGCACTCCCGTTATTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_003112.2-782s1c1
Sequence:CCGGGCAGGTAATAATCAAGCTATACTCGAGTATAGCTTGATTATTACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003112
VALIDATED
SP4 MISSION shRNA shRNA Plasmid DNA
Sp4 transcription factor
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003112.3-1511s21c1
Sequence:CCGGGTTCAACTTCAAGCAGTAAATCTCGAGATTTACTGCTTGAAGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003112.3-1544s21c1
Sequence:CCGGCTTATCAGGGCTCCAACTTTACTCGAGTAAAGTTGGAGCCCTGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003112.3-2803s21c1
Sequence:CCGGGAATCTTCCCATCTCTTAATACTCGAGTATTAAGAGATGGGAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003112.3-2743s21c1
Sequence:CCGGGTATTTCCTCCATACTATAAGCTCGAGCTTATAGTATGGAGGAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003112.3-2050s21c1
Sequence:CCGGTGCCTGTTCCTGTCCTAATTGCTCGAGCAATTAGGACAGGAACAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003112.3-1157s21c1
Sequence:CCGGACCACTGCTTCAACGTCTTTGCTCGAGCAAAGACGTTGAAGCAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003112.3-860s21c1
Sequence:CCGGCAGACAGTTCCGGTCCAAATTCTCGAGAATTTGGACCGGAACTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003112.3-940s21c1
Sequence:CCGGTGTAACAACCCTACCAATTAACTCGAGTTAATTGGTAGGGTTGTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003112.3-1103s21c1
Sequence:CCGGACTACTTCTGCCAGTACTATGCTCGAGCATAGTACTGGCAGAAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_003112.2-2557s1c1
Sequence:CCGGCCTCTAGTGCTGCACTTGTTTCTCGAGAAACAAGTGCAGCACTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003112.2-1835s1c1
Sequence:CCGGCCCGTTACAATCACTAGTGTTCTCGAGAACACTAGTGATTGTAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003112.2-1420s1c1
Sequence:CCGGGCAACAGATCATTCAGGCTATCTCGAGATAGCCTGAATGATCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003112.2-567s1c1
Sequence:CCGGGCAGTAATAACGGGAGTGCATCTCGAGATGCACTCCCGTTATTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_003112.2-782s1c1
Sequence:CCGGGCAGGTAATAATCAAGCTATACTCGAGTATAGCTTGATTATTACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003112
VALIDATED
SP4 MISSION shRNA Lentiviral Transduction Particles
Sp4 transcription factor
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003112.3-1511s21c1
Sequence:CCGGGTTCAACTTCAAGCAGTAAATCTCGAGATTTACTGCTTGAAGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003112.3-1544s21c1
Sequence:CCGGCTTATCAGGGCTCCAACTTTACTCGAGTAAAGTTGGAGCCCTGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003112.3-2803s21c1
Sequence:CCGGGAATCTTCCCATCTCTTAATACTCGAGTATTAAGAGATGGGAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003112.3-2743s21c1
Sequence:CCGGGTATTTCCTCCATACTATAAGCTCGAGCTTATAGTATGGAGGAAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003112.3-2050s21c1
Sequence:CCGGTGCCTGTTCCTGTCCTAATTGCTCGAGCAATTAGGACAGGAACAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003112.3-1157s21c1
Sequence:CCGGACCACTGCTTCAACGTCTTTGCTCGAGCAAAGACGTTGAAGCAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003112.3-860s21c1
Sequence:CCGGCAGACAGTTCCGGTCCAAATTCTCGAGAATTTGGACCGGAACTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003112.3-940s21c1
Sequence:CCGGTGTAACAACCCTACCAATTAACTCGAGTTAATTGGTAGGGTTGTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003112.3-1103s21c1
Sequence:CCGGACTACTTCTGCCAGTACTATGCTCGAGCATAGTACTGGCAGAAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_003112.2-2557s1c1
Sequence:CCGGCCTCTAGTGCTGCACTTGTTTCTCGAGAAACAAGTGCAGCACTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003112.2-1835s1c1
Sequence:CCGGCCCGTTACAATCACTAGTGTTCTCGAGAACACTAGTGATTGTAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003112.2-1420s1c1
Sequence:CCGGGCAACAGATCATTCAGGCTATCTCGAGATAGCCTGAATGATCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003112.2-567s1c1
Sequence:CCGGGCAGTAATAACGGGAGTGCATCTCGAGATGCACTCCCGTTATTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_003112.2-782s1c1
Sequence:CCGGGCAGGTAATAATCAAGCTATACTCGAGTATAGCTTGATTATTACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009239
VALIDATED
SP4 MISSION shRNA Bacterial Glycerol Stock
Sp4 transcription factor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009239.2-838s21c1
Sequence:CCGGCGTTTCAATACCATTGCAATTCTCGAGAATTGCAATGGTATTGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009239.2-924s21c1
Sequence:CCGGCTTTAGCTTTGCCAGTAATAACTCGAGTTATTACTGGCAAAGCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009239.2-2935s21c1
Sequence:CCGGTACCTGACAATAGGGATAATACTCGAGTATTATCCCTATTGTCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009239.2-330s21c1
Sequence:CCGGCTGGACAACAGCAGATTATTACTCGAGTAATAATCTGCTGTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009239.2-889s21c1
Sequence:CCGGTGTAACAACCCTACCAATTAACTCGAGTTAATTGGTAGGGTTGTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009239.1-2517s1c1
Sequence:CCGGGCACTTAAGTTTACACACCTTCTCGAGAAGGTGTGTAAACTTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009239.1-838s1c1
Sequence:CCGGCGTTTCAATACCATTGCAATTCTCGAGAATTGCAATGGTATTGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009239.1-1784s1c1
Sequence:CCGGCCAGTAACAATCACTAGTGTTCTCGAGAACACTAGTGATTGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009239.1-1014s1c1
Sequence:CCGGCCAATGGGAATCAGTTAGTTTCTCGAGAAACTAACTGATTCCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009239.1-513s1c1
Sequence:CCGGCCAGCAGTAATAACGGGAGTTCTCGAGAACTCCCGTTATTACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009239
VALIDATED
SP4 MISSION shRNA shRNA Plasmid DNA
Sp4 transcription factor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009239.2-838s21c1
Sequence:CCGGCGTTTCAATACCATTGCAATTCTCGAGAATTGCAATGGTATTGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009239.2-924s21c1
Sequence:CCGGCTTTAGCTTTGCCAGTAATAACTCGAGTTATTACTGGCAAAGCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009239.2-2935s21c1
Sequence:CCGGTACCTGACAATAGGGATAATACTCGAGTATTATCCCTATTGTCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009239.2-330s21c1
Sequence:CCGGCTGGACAACAGCAGATTATTACTCGAGTAATAATCTGCTGTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009239.2-889s21c1
Sequence:CCGGTGTAACAACCCTACCAATTAACTCGAGTTAATTGGTAGGGTTGTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009239.1-2517s1c1
Sequence:CCGGGCACTTAAGTTTACACACCTTCTCGAGAAGGTGTGTAAACTTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009239.1-838s1c1
Sequence:CCGGCGTTTCAATACCATTGCAATTCTCGAGAATTGCAATGGTATTGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009239.1-1784s1c1
Sequence:CCGGCCAGTAACAATCACTAGTGTTCTCGAGAACACTAGTGATTGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009239.1-1014s1c1
Sequence:CCGGCCAATGGGAATCAGTTAGTTTCTCGAGAAACTAACTGATTCCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009239.1-513s1c1
Sequence:CCGGCCAGCAGTAATAACGGGAGTTCTCGAGAACTCCCGTTATTACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009239
VALIDATED
SP4 MISSION shRNA Lentiviral Transduction Particles
Sp4 transcription factor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009239.2-838s21c1
Sequence:CCGGCGTTTCAATACCATTGCAATTCTCGAGAATTGCAATGGTATTGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009239.2-924s21c1
Sequence:CCGGCTTTAGCTTTGCCAGTAATAACTCGAGTTATTACTGGCAAAGCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009239.2-2935s21c1
Sequence:CCGGTACCTGACAATAGGGATAATACTCGAGTATTATCCCTATTGTCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009239.2-330s21c1
Sequence:CCGGCTGGACAACAGCAGATTATTACTCGAGTAATAATCTGCTGTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009239.2-889s21c1
Sequence:CCGGTGTAACAACCCTACCAATTAACTCGAGTTAATTGGTAGGGTTGTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009239.1-2517s1c1
Sequence:CCGGGCACTTAAGTTTACACACCTTCTCGAGAAGGTGTGTAAACTTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009239.1-838s1c1
Sequence:CCGGCGTTTCAATACCATTGCAATTCTCGAGAATTGCAATGGTATTGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009239.1-1784s1c1
Sequence:CCGGCCAGTAACAATCACTAGTGTTCTCGAGAACACTAGTGATTGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009239.1-1014s1c1
Sequence:CCGGCCAATGGGAATCAGTTAGTTTCTCGAGAAACTAACTGATTCCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009239.1-513s1c1
Sequence:CCGGCCAGCAGTAATAACGGGAGTTCTCGAGAACTCCCGTTATTACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks