EMAIL THIS PAGE TO A FRIEND

SP5

Sp5 transcription factor

UniProtKB ID: Q6BEB4
Gene ID:
Mouse(64406) trans-acting transcription factor 5
Rat(296510) Sp5 transcription factor
naked mole-rat(101724834) Sp5 transcription factor
domestic guinea pig(100727817) Sp5 transcription factor
cow(512467) Sp5 transcription factor
sheep(101107678) Sp5 transcription factor
Zebrafish(353154) Sp5 transcription factor
domestic cat(101088603) Sp5 transcription factor
chicken(693261) Sp5 transcription factor
dog(609211) Sp5 transcription factor
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022435 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022435 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022435 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001003845 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003845 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003845 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003845 Rosetta Predictions human pricing
NM_001106552 Rosetta Predictions rat pricing
NM_022435 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115879 predicted 1220
2 SASI_Hs01_00115880 predicted 1275
3 SASI_Hs01_00115881 predicted 1277
4 SASI_Hs01_00115882 predicted 1281
5 SASI_Hs01_00115884 predicted 1289
6 SASI_Hs01_00115885 predicted 1149
7 SASI_Hs01_00115886 predicted 1559
8 SASI_Hs01_00115887 predicted 1377
9 SASI_Hs01_00115883 predicted 1447
10 SASI_Hs02_00304413 predicted 1699
11 SASI_Hs01_00115888 predicted 1850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106552 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220078 predicted 1417
2 SASI_Rn02_00220079 predicted 522
3 SASI_Rn02_00220080 predicted 1505
4 SASI_Rn02_00220081 predicted 1443
5 SASI_Rn02_00220082 predicted 517
6 SASI_Rn02_00220083 predicted 698
7 SASI_Rn02_00220084 predicted 623
8 SASI_Rn02_00220085 predicted 1607
9 SASI_Rn02_00220086 predicted 1453
10 SASI_Rn02_00220087 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128109 predicted 1423
2 SASI_Mm01_00128110 predicted 1511
3 SASI_Mm01_00128111 predicted 528
4 SASI_Mm01_00128112 predicted 1612
5 SASI_Mm01_00128113 predicted 1618
6 SASI_Mm01_00128115 predicted 1457
7 SASI_Mm01_00128116 predicted 523
8 SASI_Mm01_00128118 predicted 1602
9 SASI_Mm02_00326611 predicted 1604
10 SASI_Mm02_00326612 predicted 1526
11 SASI_Mm01_00128114 predicted 1438
12 SASI_Mm01_00128117 predicted 1568
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022435
VALIDATED
SP5 MISSION shRNA Bacterial Glycerol Stock
Sp5 transcription factor
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022435.2-1910s1c1
Sequence:CCGGCGGACTTTGTACAGGTTATTTCTCGAGAAATAACCTGTACAAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022435.2-1072s1c1
Sequence:CCGGCCCGTCGGACTTTGCACAGTACTCGAGTACTGTGCAAAGTCCGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022435.2-500s1c1
Sequence:CCGGGACTTCCTTCAGGTGCCCTATCTCGAGATAGGGCACCTGAAGGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022435.2-1441s1c1
Sequence:CCGGGCGAAGCGATCACCTCGCCAACTCGAGTTGGCGAGGTGATCGCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022435.2-1619s21c1
Sequence:CCGGCCATCGAGGTAGCTGACAAAGCTCGAGCTTTGTCAGCTACCTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022435.2-709s21c1
Sequence:CCGGTTACGAGTTCTCGCCGGTCAACTCGAGTTGACCGGCGAGAACTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022435.2-1485s21c1
Sequence:CCGGAGAAGCTCAAAGTCGCTGAGGCTCGAGCCTCAGCGACTTTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022435.2-531s21c1
Sequence:CCGGTGGGTTCACCCTCCAGACTTTCTCGAGAAAGTCTGGAGGGTGAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022435.2-1782s21c1
Sequence:CCGGCTGCCTGGGAGACTTACATTTCTCGAGAAATGTAAGTCTCCCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022435.2-1461s21c1
Sequence:CCGGAGCACGTGAAGACGCACCAAACTCGAGTTTGGTGCGTCTTCACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022435.2-1422s21c1
Sequence:CCGGAGTGCGGCAAACGCTTCATGCCTCGAGGCATGAAGCGTTTGCCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022435
VALIDATED
SP5 MISSION shRNA shRNA Plasmid DNA
Sp5 transcription factor
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022435.2-1910s1c1
Sequence:CCGGCGGACTTTGTACAGGTTATTTCTCGAGAAATAACCTGTACAAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022435.2-1072s1c1
Sequence:CCGGCCCGTCGGACTTTGCACAGTACTCGAGTACTGTGCAAAGTCCGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022435.2-500s1c1
Sequence:CCGGGACTTCCTTCAGGTGCCCTATCTCGAGATAGGGCACCTGAAGGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022435.2-1441s1c1
Sequence:CCGGGCGAAGCGATCACCTCGCCAACTCGAGTTGGCGAGGTGATCGCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022435.2-1619s21c1
Sequence:CCGGCCATCGAGGTAGCTGACAAAGCTCGAGCTTTGTCAGCTACCTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022435.2-709s21c1
Sequence:CCGGTTACGAGTTCTCGCCGGTCAACTCGAGTTGACCGGCGAGAACTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022435.2-1485s21c1
Sequence:CCGGAGAAGCTCAAAGTCGCTGAGGCTCGAGCCTCAGCGACTTTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022435.2-531s21c1
Sequence:CCGGTGGGTTCACCCTCCAGACTTTCTCGAGAAAGTCTGGAGGGTGAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022435.2-1782s21c1
Sequence:CCGGCTGCCTGGGAGACTTACATTTCTCGAGAAATGTAAGTCTCCCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022435.2-1461s21c1
Sequence:CCGGAGCACGTGAAGACGCACCAAACTCGAGTTTGGTGCGTCTTCACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022435.2-1422s21c1
Sequence:CCGGAGTGCGGCAAACGCTTCATGCCTCGAGGCATGAAGCGTTTGCCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022435
VALIDATED
SP5 MISSION shRNA Lentiviral Transduction Particles
Sp5 transcription factor
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022435.2-1910s1c1
Sequence:CCGGCGGACTTTGTACAGGTTATTTCTCGAGAAATAACCTGTACAAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022435.2-1072s1c1
Sequence:CCGGCCCGTCGGACTTTGCACAGTACTCGAGTACTGTGCAAAGTCCGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022435.2-500s1c1
Sequence:CCGGGACTTCCTTCAGGTGCCCTATCTCGAGATAGGGCACCTGAAGGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022435.2-1441s1c1
Sequence:CCGGGCGAAGCGATCACCTCGCCAACTCGAGTTGGCGAGGTGATCGCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022435.2-1619s21c1
Sequence:CCGGCCATCGAGGTAGCTGACAAAGCTCGAGCTTTGTCAGCTACCTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022435.2-709s21c1
Sequence:CCGGTTACGAGTTCTCGCCGGTCAACTCGAGTTGACCGGCGAGAACTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022435.2-1485s21c1
Sequence:CCGGAGAAGCTCAAAGTCGCTGAGGCTCGAGCCTCAGCGACTTTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022435.2-531s21c1
Sequence:CCGGTGGGTTCACCCTCCAGACTTTCTCGAGAAAGTCTGGAGGGTGAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022435.2-1782s21c1
Sequence:CCGGCTGCCTGGGAGACTTACATTTCTCGAGAAATGTAAGTCTCCCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022435.2-1461s21c1
Sequence:CCGGAGCACGTGAAGACGCACCAAACTCGAGTTTGGTGCGTCTTCACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022435.2-1422s21c1
Sequence:CCGGAGTGCGGCAAACGCTTCATGCCTCGAGGCATGAAGCGTTTGCCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003845
SP5 MISSION shRNA Bacterial Glycerol Stock
Sp5 transcription factor
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003845.1-1686s1c1
Sequence:CCGGGCTGAACTGAATAGAAAGGAACTCGAGTTCCTTTCTATTCAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003845.1-1294s1c1
Sequence:CCGGCACCAGAATAAGAAGCTCAAACTCGAGTTTGAGCTTCTTATTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003845.1-528s1c1
Sequence:CCGGCTACGAGTTCTCGCCGGTCAACTCGAGTTGACCGGCGAGAACTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003845.1-891s1c1
Sequence:CCGGCCCGTCGGACTTTGCGCAGTACTCGAGTACTGCGCAAAGTCCGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003845.1-1283s1c1
Sequence:CCGGACGTCAAGACTCACCAGAATACTCGAGTATTCTGGTGAGTCTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003845.2-1630s21c1
Sequence:CCGGGTCAGGGAGACCTACAGTTTCCTCGAGGAAACTGTAGGTCTCCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003845.2-1275s21c1
Sequence:CCGCACCTCGCGAAGCACGTCAAGACTCGAGTCTTGACGTGCTTCGCGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003845
SP5 MISSION shRNA shRNA Plasmid DNA
Sp5 transcription factor
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003845.1-1686s1c1
Sequence:CCGGGCTGAACTGAATAGAAAGGAACTCGAGTTCCTTTCTATTCAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003845.1-1294s1c1
Sequence:CCGGCACCAGAATAAGAAGCTCAAACTCGAGTTTGAGCTTCTTATTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003845.1-528s1c1
Sequence:CCGGCTACGAGTTCTCGCCGGTCAACTCGAGTTGACCGGCGAGAACTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003845.1-891s1c1
Sequence:CCGGCCCGTCGGACTTTGCGCAGTACTCGAGTACTGCGCAAAGTCCGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003845.1-1283s1c1
Sequence:CCGGACGTCAAGACTCACCAGAATACTCGAGTATTCTGGTGAGTCTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003845.2-1630s21c1
Sequence:CCGGGTCAGGGAGACCTACAGTTTCCTCGAGGAAACTGTAGGTCTCCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003845.2-1275s21c1
Sequence:CCGCACCTCGCGAAGCACGTCAAGACTCGAGTCTTGACGTGCTTCGCGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003845
SP5 MISSION shRNA Lentiviral Transduction Particles
Sp5 transcription factor
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108215    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003845.1-1686s1c1
Sequence:CCGGGCTGAACTGAATAGAAAGGAACTCGAGTTCCTTTCTATTCAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003845.1-1294s1c1
Sequence:CCGGCACCAGAATAAGAAGCTCAAACTCGAGTTTGAGCTTCTTATTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003845.1-528s1c1
Sequence:CCGGCTACGAGTTCTCGCCGGTCAACTCGAGTTGACCGGCGAGAACTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003845.1-891s1c1
Sequence:CCGGCCCGTCGGACTTTGCGCAGTACTCGAGTACTGCGCAAAGTCCGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003845.1-1283s1c1
Sequence:CCGGACGTCAAGACTCACCAGAATACTCGAGTATTCTGGTGAGTCTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003845.2-1630s21c1
Sequence:CCGGGTCAGGGAGACCTACAGTTTCCTCGAGGAAACTGTAGGTCTCCCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003845.2-1275s21c1
Sequence:CCGCACCTCGCGAAGCACGTCAAGACTCGAGTCTTGACGTGCTTCGCGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks