EMAIL THIS PAGE TO A FRIEND

SP6

Sp6 transcription factor

Synonyms: EPFN EPIPROFIN KLF14
UniProtKB ID: Q3SY56, B3KXS4
Gene ID:
Human(80320) Summary: SP6 belongs to a family of transcription factors that contain 3 classical zinc finger DNA-binding domains consisting of a zinc atom tetrahedrally coordinated by 2 cysteines and 2 histidines (C2H2 motif). These transcription factors bind to GC-rich sequences and related GT and CACCC boxes (Scohy et al., 2000 [PubMed 11087666]
Mouse(83395) trans-acting transcription factor 6
Rat(363672) Sp6 transcription factor
domestic cat(101085507) Sp6 transcription factor
Horse(100055446) Sp6 transcription factor
dog(491047) Sp6 transcription factor
cow(540288) Sp6 transcription factor
domestic guinea pig(100718383) Sp6 transcription factor
naked mole-rat(101701318) Sp6 transcription factor
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199262 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199262 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199262 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031183 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031183 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031183 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU052271 MISSION® esiRNA esiRNA targeting mouse Sp6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199262 Rosetta Predictions human pricing
NM_001108833 Rosetta Predictions rat pricing
NM_031183 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096194 predicted 1506
2 SASI_Hs01_00096197 predicted 1575
3 SASI_Hs01_00096198 predicted 1593
4 SASI_Hs01_00096199 predicted 565
5 SASI_Hs02_00372688 predicted 1072
6 SASI_Hs01_00096201 predicted 1224
7 SASI_Hs01_00096202 predicted 454
8 SASI_Hs01_00096203 predicted 573
9 SASI_Hs02_00372689 predicted 676
10 SASI_Hs02_00372690 predicted 1235
11 SASI_Hs01_00096195 predicted 1818
12 SASI_Hs01_00096196 predicted 1871
13 SASI_Hs01_00096200 predicted 1018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108833 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242525 predicted 1702
2 SASI_Rn02_00242526 predicted 1688
3 SASI_Rn02_00242527 predicted 1453
4 SASI_Rn02_00242528 predicted 1347
5 SASI_Rn02_00242529 predicted 758
6 SASI_Rn02_00242530 predicted 715
7 SASI_Rn02_00242531 predicted 1215
8 SASI_Rn02_00242532 predicted 1672
9 SASI_Rn02_00242533 predicted 1464
10 SASI_Rn02_00242534 predicted 1455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031183 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160088 predicted 889
2 SASI_Mm01_00160089 predicted 1570
3 SASI_Mm01_00160090 predicted 385
4 SASI_Mm01_00160092 predicted 725
5 SASI_Mm02_00337025 predicted 1524
6 SASI_Mm01_00160093 predicted 374
7 SASI_Mm01_00160094 predicted 665
8 SASI_Mm01_00160095 predicted 1570
9 SASI_Mm01_00160096 predicted 1662
10 SASI_Mm01_00160097 predicted 382
11 SASI_Mm01_00160091 predicted 714
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199262
SP6 MISSION shRNA Bacterial Glycerol Stock
Sp6 transcription factor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199262.2-1866s21c1
Sequence:CCGGGTCCCTTTCATCCCACTTAAACTCGAGTTTAAGTGGGATGAAAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199262.2-1229s21c1
Sequence:CCGGAGTCTGCAGCCGCGTCTTCATCTCGAGATGAAGACGCGGCTGCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199262.2-1584s21c1
Sequence:CCGGGCTACTAGGCAGGATGAATTTCTCGAGAAATTCATCCTGCCTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199262.2-1031s1c1
Sequence:CCGGGCATTTGCACAACTGCCACATCTCGAGATGTGGCAGTTGTGCAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199262.2-868s1c1
Sequence:CCGGCGGAGTCTCAAGGGCTGGATTCTCGAGAATCCAGCCCTTGAGACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199262.2-581s1c1
Sequence:CCGGACACCATTATGAATCGTGGTTCTCGAGAACCACGATTCATAATGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199262.2-1073s1c1
Sequence:CCGGCGCCAAGACGTCGCACCTGAACTCGAGTTCAGGTGCGACGTCTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199262.2-570s1c1
Sequence:CCGGCCGGACATGTCACACCATTATCTCGAGATAATGGTGTGACATGTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199262
SP6 MISSION shRNA shRNA Plasmid DNA
Sp6 transcription factor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199262.2-1866s21c1
Sequence:CCGGGTCCCTTTCATCCCACTTAAACTCGAGTTTAAGTGGGATGAAAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199262.2-1229s21c1
Sequence:CCGGAGTCTGCAGCCGCGTCTTCATCTCGAGATGAAGACGCGGCTGCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199262.2-1584s21c1
Sequence:CCGGGCTACTAGGCAGGATGAATTTCTCGAGAAATTCATCCTGCCTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199262.2-1031s1c1
Sequence:CCGGGCATTTGCACAACTGCCACATCTCGAGATGTGGCAGTTGTGCAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199262.2-868s1c1
Sequence:CCGGCGGAGTCTCAAGGGCTGGATTCTCGAGAATCCAGCCCTTGAGACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199262.2-581s1c1
Sequence:CCGGACACCATTATGAATCGTGGTTCTCGAGAACCACGATTCATAATGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199262.2-1073s1c1
Sequence:CCGGCGCCAAGACGTCGCACCTGAACTCGAGTTCAGGTGCGACGTCTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199262.2-570s1c1
Sequence:CCGGCCGGACATGTCACACCATTATCTCGAGATAATGGTGTGACATGTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199262
SP6 MISSION shRNA Lentiviral Transduction Particles
Sp6 transcription factor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199262.2-1866s21c1
Sequence:CCGGGTCCCTTTCATCCCACTTAAACTCGAGTTTAAGTGGGATGAAAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199262.2-1229s21c1
Sequence:CCGGAGTCTGCAGCCGCGTCTTCATCTCGAGATGAAGACGCGGCTGCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199262.2-1584s21c1
Sequence:CCGGGCTACTAGGCAGGATGAATTTCTCGAGAAATTCATCCTGCCTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199262.2-1031s1c1
Sequence:CCGGGCATTTGCACAACTGCCACATCTCGAGATGTGGCAGTTGTGCAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199262.2-868s1c1
Sequence:CCGGCGGAGTCTCAAGGGCTGGATTCTCGAGAATCCAGCCCTTGAGACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199262.2-581s1c1
Sequence:CCGGACACCATTATGAATCGTGGTTCTCGAGAACCACGATTCATAATGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199262.2-1073s1c1
Sequence:CCGGCGCCAAGACGTCGCACCTGAACTCGAGTTCAGGTGCGACGTCTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199262.2-570s1c1
Sequence:CCGGCCGGACATGTCACACCATTATCTCGAGATAATGGTGTGACATGTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031183
VALIDATED
SP6 MISSION shRNA Bacterial Glycerol Stock
Sp6 transcription factor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031183.1-846s21c1
Sequence:GTACCGGGAAGAAGCATTTGCACAATTGCTCGAGCAATTGTGCAAATGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031183.1-1759s21c1
Sequence:CCGGACCTAGCTTGGAGGGTTATTACTCGAGTAATAACCCTCCAAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031183.1-891s21c1
Sequence:CCGGATACGCTAAGACGTCGCATCTCTCGAGAGATGCGACGTCTTAGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031183.1-392s21c1
Sequence:CCGGCGGACATGTCACACCACTATGCTCGAGCATAGTGGTGTGACATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031183.1-326s21c1
Sequence:CCGGTAACCTGCGAGGACCTGGAAACTCGAGTTTCCAGGTCCTCGCAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031183.1-3203s1c1
Sequence:CCGGGCCTGCTCTTTATCAAATCTACTCGAGTAGATTTGATAAAGAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031183.1-390s1c1
Sequence:CCGGGCCGGACATGTCACACCACTACTCGAGTAGTGGTGTGACATGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031183.1-894s1c1
Sequence:CCGGCGCTAAGACGTCGCATCTGAACTCGAGTTCAGATGCGACGTCTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031183.1-1081s1c1
Sequence:CCGGCACCTGGCCAAACACATGAAACTCGAGTTTCATGTGTTTGGCCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031183.1-852s1c1
Sequence:CCGGGCATTTGCACAATTGCCACATCTCGAGATGTGGCAATTGTGCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031183
VALIDATED
SP6 MISSION shRNA shRNA Plasmid DNA
Sp6 transcription factor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031183.1-846s21c1
Sequence:GTACCGGGAAGAAGCATTTGCACAATTGCTCGAGCAATTGTGCAAATGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031183.1-1759s21c1
Sequence:CCGGACCTAGCTTGGAGGGTTATTACTCGAGTAATAACCCTCCAAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031183.1-891s21c1
Sequence:CCGGATACGCTAAGACGTCGCATCTCTCGAGAGATGCGACGTCTTAGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031183.1-392s21c1
Sequence:CCGGCGGACATGTCACACCACTATGCTCGAGCATAGTGGTGTGACATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031183.1-326s21c1
Sequence:CCGGTAACCTGCGAGGACCTGGAAACTCGAGTTTCCAGGTCCTCGCAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031183.1-3203s1c1
Sequence:CCGGGCCTGCTCTTTATCAAATCTACTCGAGTAGATTTGATAAAGAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031183.1-390s1c1
Sequence:CCGGGCCGGACATGTCACACCACTACTCGAGTAGTGGTGTGACATGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031183.1-894s1c1
Sequence:CCGGCGCTAAGACGTCGCATCTGAACTCGAGTTCAGATGCGACGTCTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031183.1-1081s1c1
Sequence:CCGGCACCTGGCCAAACACATGAAACTCGAGTTTCATGTGTTTGGCCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031183.1-852s1c1
Sequence:CCGGGCATTTGCACAATTGCCACATCTCGAGATGTGGCAATTGTGCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031183
VALIDATED
SP6 MISSION shRNA Lentiviral Transduction Particles
Sp6 transcription factor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031183.1-846s21c1
Sequence:GTACCGGGAAGAAGCATTTGCACAATTGCTCGAGCAATTGTGCAAATGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031183.1-1759s21c1
Sequence:CCGGACCTAGCTTGGAGGGTTATTACTCGAGTAATAACCCTCCAAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031183.1-891s21c1
Sequence:CCGGATACGCTAAGACGTCGCATCTCTCGAGAGATGCGACGTCTTAGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031183.1-392s21c1
Sequence:CCGGCGGACATGTCACACCACTATGCTCGAGCATAGTGGTGTGACATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031183.1-326s21c1
Sequence:CCGGTAACCTGCGAGGACCTGGAAACTCGAGTTTCCAGGTCCTCGCAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031183.1-3203s1c1
Sequence:CCGGGCCTGCTCTTTATCAAATCTACTCGAGTAGATTTGATAAAGAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031183.1-390s1c1
Sequence:CCGGGCCGGACATGTCACACCACTACTCGAGTAGTGGTGTGACATGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031183.1-894s1c1
Sequence:CCGGCGCTAAGACGTCGCATCTGAACTCGAGTTCAGATGCGACGTCTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031183.1-1081s1c1
Sequence:CCGGCACCTGGCCAAACACATGAAACTCGAGTTTCATGTGTTTGGCCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031183.1-852s1c1
Sequence:CCGGGCATTTGCACAATTGCCACATCTCGAGATGTGGCAATTGTGCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks