EMAIL THIS PAGE TO A FRIEND

SP7

Sp7 transcription factor

Synonyms: OI11 OI12 OSX osterix
UniProtKB ID: Q8TDD2, B3KY26, Q3MJ72, Q7Z718
Gene ID:
Human(121340) Summary: This gene encodes a member of the Sp subfamily of Sp/XKLF transcription factors. Sp family proteins are sequence-specific DNA-binding proteins characterized by an amino-terminal trans-activation domain and three carboxy-terminal zinc finger motifs. This protein is a bone specific transcription factor and is required for osteoblast differentiation and bone formation.[provided by RefSeq, Jul 2010]
Mouse(170574) Sp7 transcription factor 7
Rat(300260) Sp7 transcription factor
naked mole-rat(101697133) Sp7 transcription factor
domestic guinea pig(100732690) Sp7 transcription factor
cow(531995) Sp7 transcription factor
sheep(101104389) Sp7 transcription factor
fruit fly(40918) Serine protease 7
Horse(100063836) Sp7 transcription factor
domestic cat(101085476) Sp7 transcription factor
dog(607857) Sp7 transcription factor
Zebrafish(405789) Sp7 transcription factor
120 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130458 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130458 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130458 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152860 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152860 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152860 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU089831 MISSION® esiRNA esiRNA targeting mouse Sp7 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152860 Rosetta Predictions human pricing
NM_001037632 Rosetta Predictions rat pricing
NM_181374 Rosetta Predictions rat pricing
NM_130458 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035185 predicted 1531
2 SASI_Hs01_00035186 predicted 808
3 SASI_Hs01_00035187 predicted 1803
4 SASI_Hs01_00035188 predicted 1693
5 SASI_Hs01_00035189 predicted 364
6 SASI_Hs01_00035190 predicted 1798
7 SASI_Hs01_00035191 predicted 322
8 SASI_Hs01_00035192 predicted 915
9 SASI_Hs01_00035193 predicted 1819
10 SASI_Hs01_00035194 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037632 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102433 predicted 1131
2 SASI_Rn01_00102434 predicted 573
3 SASI_Rn01_00102435 predicted 791
4 SASI_Rn01_00102438 predicted 465
5 SASI_Rn02_00204508 predicted 555
6 SASI_Rn01_00102439 predicted 907
7 SASI_Rn02_00204509 predicted 1271
8 SASI_Rn01_00102440 predicted 1220
9 SASI_Rn01_00102441 predicted 578
10 SASI_Rn01_00102442 predicted 792
11 SASI_Rn01_00102436 predicted 1080
12 SASI_Rn01_00102437 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181374 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095459 predicted 1005
2 SASI_Rn01_00095460 predicted 453
3 SASI_Rn01_00095461 predicted 669
4 SASI_Rn01_00095464 predicted 339
5 SASI_Rn02_00269706 predicted 440
6 SASI_Rn01_00095465 predicted 789
7 SASI_Rn02_00269707 predicted 1144
8 SASI_Rn01_00095466 predicted 1092
9 SASI_Rn01_00095467 predicted 455
10 SASI_Rn01_00095468 predicted 666
11 SASI_Rn01_00095462 predicted 958
12 SASI_Rn01_00095463 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130458 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040522 predicted 941
2 SASI_Mm01_00040523 predicted 610
3 SASI_Mm01_00040524 predicted 410
4 SASI_Mm01_00040526 predicted 915
5 SASI_Mm01_00040527 predicted 418
6 SASI_Mm01_00040528 predicted 382
7 SASI_Mm01_00040529 predicted 392
8 SASI_Mm01_00040530 predicted 1403
9 SASI_Mm02_00338267 predicted 406
10 SASI_Mm01_00040531 predicted 380
11 SASI_Mm01_00040525 predicted 463
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130458
SP7 MISSION shRNA Bacterial Glycerol Stock
Sp7 transcription factor
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130458.1-2477s1c1
Sequence:CCGGGCCATCTTAAACGTGCTCTTTCTCGAGAAAGAGCACGTTTAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130458.1-675s1c1
Sequence:CCGGGCCTACTTACCCATCTGACTTCTCGAGAAGTCAGATGGGTAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130458.1-1176s1c1
Sequence:CCGGCTTTACCAGAAGCGACCACTTCTCGAGAAGTGGTCGCTTCTGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130458.1-474s1c1
Sequence:CCGGCCTGGATATGACTCATCCCTACTCGAGTAGGGATGAGTCATATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130458.1-170s1c1
Sequence:CCGGGCAGCAAATTTGGCGGCTCTACTCGAGTAGAGCCGCCAAATTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130458.3-945s21c1
Sequence:CCGGGCAAGGCTTCGCATCTGAAAGCTCGAGCTTTCAGATGCGAAGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130458.3-1407s21c1
Sequence:CCGGCTCTCCTATTGCATGCTATACCTCGAGGTATAGCATGCAATAGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130458.3-1644s21c1
Sequence:CCGGTCTGCTTCCCAATCCTATTTGCTCGAGCAAATAGGATTGGGAAGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130458
SP7 MISSION shRNA shRNA Plasmid DNA
Sp7 transcription factor
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130458.1-2477s1c1
Sequence:CCGGGCCATCTTAAACGTGCTCTTTCTCGAGAAAGAGCACGTTTAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130458.1-675s1c1
Sequence:CCGGGCCTACTTACCCATCTGACTTCTCGAGAAGTCAGATGGGTAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130458.1-1176s1c1
Sequence:CCGGCTTTACCAGAAGCGACCACTTCTCGAGAAGTGGTCGCTTCTGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130458.1-474s1c1
Sequence:CCGGCCTGGATATGACTCATCCCTACTCGAGTAGGGATGAGTCATATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130458.1-170s1c1
Sequence:CCGGGCAGCAAATTTGGCGGCTCTACTCGAGTAGAGCCGCCAAATTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130458.3-945s21c1
Sequence:CCGGGCAAGGCTTCGCATCTGAAAGCTCGAGCTTTCAGATGCGAAGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130458.3-1407s21c1
Sequence:CCGGCTCTCCTATTGCATGCTATACCTCGAGGTATAGCATGCAATAGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130458.3-1644s21c1
Sequence:CCGGTCTGCTTCCCAATCCTATTTGCTCGAGCAAATAGGATTGGGAAGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130458
SP7 MISSION shRNA Lentiviral Transduction Particles
Sp7 transcription factor
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130458.1-2477s1c1
Sequence:CCGGGCCATCTTAAACGTGCTCTTTCTCGAGAAAGAGCACGTTTAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130458.1-675s1c1
Sequence:CCGGGCCTACTTACCCATCTGACTTCTCGAGAAGTCAGATGGGTAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130458.1-1176s1c1
Sequence:CCGGCTTTACCAGAAGCGACCACTTCTCGAGAAGTGGTCGCTTCTGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130458.1-474s1c1
Sequence:CCGGCCTGGATATGACTCATCCCTACTCGAGTAGGGATGAGTCATATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130458.1-170s1c1
Sequence:CCGGGCAGCAAATTTGGCGGCTCTACTCGAGTAGAGCCGCCAAATTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130458.3-945s21c1
Sequence:CCGGGCAAGGCTTCGCATCTGAAAGCTCGAGCTTTCAGATGCGAAGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130458.3-1407s21c1
Sequence:CCGGCTCTCCTATTGCATGCTATACCTCGAGGTATAGCATGCAATAGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130458.3-1644s21c1
Sequence:CCGGTCTGCTTCCCAATCCTATTTGCTCGAGCAAATAGGATTGGGAAGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152860
SP7 MISSION shRNA Bacterial Glycerol Stock
Sp7 transcription factor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152860.1-361s1c1
Sequence:CCGGCCTCAGGCTATGCTAATGATTCTCGAGAATCATTAGCATAGCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152860.1-312s1c1
Sequence:CCGGACAAGCACTAATGGGCTCCTTCTCGAGAAGGAGCCCATTAGTGCTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152860.1-781s1c1
Sequence:CCGGCCCAAGATGTCTATAAACCCACTCGAGTGGGTTTATAGACATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152860.1-372s1c1
Sequence:CCGGGCTAATGATTACCCTCCCTTTCTCGAGAAAGGGAGGGTAATCATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152860.1-178s1c1
Sequence:CCGGGCAGCAAATTTGGTGGCTCTACTCGAGTAGAGCCACCAAATTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152860.1-530s21c1
Sequence:CCGGAGGCATCCATGCAGGCATTTCCTCGAGGAAATGCCTGCATGGATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152860.1-570s21c1
Sequence:CCGGCCTACTCCATGGTGGGATATGCTCGAGCATATCCCACCATGGAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152860.1-1752s21c1
Sequence:CCGGTTCTGCTTCTCAAGCTTATTTCTCGAGAAATAAGCTTGAGAAGCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152860
SP7 MISSION shRNA shRNA Plasmid DNA
Sp7 transcription factor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152860.1-361s1c1
Sequence:CCGGCCTCAGGCTATGCTAATGATTCTCGAGAATCATTAGCATAGCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152860.1-312s1c1
Sequence:CCGGACAAGCACTAATGGGCTCCTTCTCGAGAAGGAGCCCATTAGTGCTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152860.1-781s1c1
Sequence:CCGGCCCAAGATGTCTATAAACCCACTCGAGTGGGTTTATAGACATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152860.1-372s1c1
Sequence:CCGGGCTAATGATTACCCTCCCTTTCTCGAGAAAGGGAGGGTAATCATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152860.1-178s1c1
Sequence:CCGGGCAGCAAATTTGGTGGCTCTACTCGAGTAGAGCCACCAAATTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152860.1-530s21c1
Sequence:CCGGAGGCATCCATGCAGGCATTTCCTCGAGGAAATGCCTGCATGGATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152860.1-570s21c1
Sequence:CCGGCCTACTCCATGGTGGGATATGCTCGAGCATATCCCACCATGGAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152860.1-1752s21c1
Sequence:CCGGTTCTGCTTCTCAAGCTTATTTCTCGAGAAATAAGCTTGAGAAGCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152860
SP7 MISSION shRNA Lentiviral Transduction Particles
Sp7 transcription factor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152860.1-361s1c1
Sequence:CCGGCCTCAGGCTATGCTAATGATTCTCGAGAATCATTAGCATAGCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152860.1-312s1c1
Sequence:CCGGACAAGCACTAATGGGCTCCTTCTCGAGAAGGAGCCCATTAGTGCTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152860.1-781s1c1
Sequence:CCGGCCCAAGATGTCTATAAACCCACTCGAGTGGGTTTATAGACATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152860.1-372s1c1
Sequence:CCGGGCTAATGATTACCCTCCCTTTCTCGAGAAAGGGAGGGTAATCATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152860.1-178s1c1
Sequence:CCGGGCAGCAAATTTGGTGGCTCTACTCGAGTAGAGCCACCAAATTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152860.1-530s21c1
Sequence:CCGGAGGCATCCATGCAGGCATTTCCTCGAGGAAATGCCTGCATGGATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152860.1-570s21c1
Sequence:CCGGCCTACTCCATGGTGGGATATGCTCGAGCATATCCCACCATGGAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152860.1-1752s21c1
Sequence:CCGGTTCTGCTTCTCAAGCTTATTTCTCGAGAAATAAGCTTGAGAAGCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks