EMAIL THIS PAGE TO A FRIEND

SP8

Sp8 transcription factor

Synonyms: BTD
UniProtKB ID: Q8IXZ3, Q7Z615, Q7Z616, Q96MJ1
Gene ID:
Human(221833) Summary: The protein encoded by this gene is an SP family transcription factor that in mouse has been shown to be essential for proper limb development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Mouse(320145) trans-acting transcription factor 8
Rat(299499) Sp8 transcription factor
chicken(776034) Sp8 transcription factor
domestic cat(101094745) Sp8 transcription factor
dog(610985) Sp8 transcription factor
cow(784504) Sp8 transcription factor
domestic guinea pig(100725117) Sp8 transcription factor
naked mole-rat(101702366) Sp8 transcription factor
178 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182700 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182700 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182700 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177082 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177082 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177082 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182700 Rosetta Predictions human pricing
NM_198956 Rosetta Predictions human pricing
XM_001053894 Rosetta Predictions rat pricing
XM_234724 Rosetta Predictions rat pricing
NM_177082 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245242 predicted 912
2 SASI_Hs01_00245243 predicted 1754
3 SASI_Hs01_00245244 predicted 1937
4 SASI_Hs01_00245245 predicted 1692
5 SASI_Hs02_00370865 predicted 1675
6 SASI_Hs01_00245246 predicted 1786
7 SASI_Hs01_00245247 predicted 1891
8 SASI_Hs01_00245248 predicted 881
9 SASI_Hs01_00245249 predicted 1938
10 SASI_Hs01_00245251 predicted 896
11 SASI_Hs01_00245250 predicted 1984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204818 predicted 1003
2 SASI_Hs01_00204819 predicted 1855
3 SASI_Hs01_00204820 predicted 2032
4 SASI_Hs01_00204821 predicted 1790
5 SASI_Hs02_00372469 predicted 1770
6 SASI_Hs01_00204822 predicted 1878
7 SASI_Hs01_00204823 predicted 1981
8 SASI_Hs01_00204824 predicted 981
9 SASI_Hs01_00204825 predicted 2030
10 SASI_Hs01_00204827 predicted 988
11 SASI_Hs01_00204826 predicted 2080
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053894 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273948 predicted 931
2 SASI_Rn02_00273949 predicted 2128
3 SASI_Rn02_00273950 predicted 1622
4 SASI_Rn02_00273951 predicted 1750
5 SASI_Rn02_00273952 predicted 2122
6 SASI_Rn02_00273953 predicted 1651
7 SASI_Rn02_00273954 predicted 1789
8 SASI_Rn02_00273955 predicted 1817
9 SASI_Rn02_00273956 predicted 1923
10 SASI_Rn02_00273957 predicted 2087
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234724 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388647 predicted 930
2 SASI_Rn02_00388648 predicted 1625
3 SASI_Rn02_00388649 predicted 650
4 SASI_Rn02_00388650 predicted 2126
5 SASI_Rn02_00388651 predicted 1651
6 SASI_Rn02_00388652 predicted 728
7 SASI_Rn02_00388653 predicted 309
8 SASI_Rn02_00388654 predicted 192
9 SASI_Rn02_00388655 predicted 330
10 SASI_Rn02_00388656 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177082 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191312 predicted 869
2 SASI_Mm01_00191313 predicted 1685
3 SASI_Mm01_00191314 predicted 1751
4 SASI_Mm01_00191315 predicted 261
5 SASI_Mm01_00191316 predicted 879
6 SASI_Mm01_00191317 predicted 841
7 SASI_Mm01_00191318 predicted 260
8 SASI_Mm01_00191319 predicted 269
9 SASI_Mm01_00191320 predicted 1796
10 SASI_Mm01_00191321 predicted 1800
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182700
SP8 MISSION shRNA Bacterial Glycerol Stock
Sp8 transcription factor
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182700.4-1983s21c1
Sequence:CCGGTGGAGGTAGAGCTGGACTAATCTCGAGATTAGTCCAGCTCTACCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182700.4-694s21c1
Sequence:CCGGCCCGTACGAGTCGTGGTTTAACTCGAGTTAAACCACGACTCGTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182700.2-613s1c1
Sequence:CCGGCCAGCCGGTGTTCATCTCCAACTCGAGTTGGAGATGAACACCGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182700.2-1429s1c1
Sequence:CCGGCCACCTCAGCAAGCACGTGAACTCGAGTTCACGTGCTTGCTGAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182700.2-145s1c1
Sequence:CCGGGCTTGCCGCTACCTGTAATAACTCGAGTTATTACAGGTAGCGGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182700.2-886s1c1
Sequence:CCGGCGGAGGCTACAACTCGGATTACTCGAGTAATCCGAGTTGTAGCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182700.2-205s1c1
Sequence:CCGGCAGCTCTTCTTCCTTCGGCAACTCGAGTTGCCGAAGGAAGAAGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182700
SP8 MISSION shRNA shRNA Plasmid DNA
Sp8 transcription factor
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182700.4-1983s21c1
Sequence:CCGGTGGAGGTAGAGCTGGACTAATCTCGAGATTAGTCCAGCTCTACCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182700.4-694s21c1
Sequence:CCGGCCCGTACGAGTCGTGGTTTAACTCGAGTTAAACCACGACTCGTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182700.2-613s1c1
Sequence:CCGGCCAGCCGGTGTTCATCTCCAACTCGAGTTGGAGATGAACACCGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182700.2-1429s1c1
Sequence:CCGGCCACCTCAGCAAGCACGTGAACTCGAGTTCACGTGCTTGCTGAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182700.2-145s1c1
Sequence:CCGGGCTTGCCGCTACCTGTAATAACTCGAGTTATTACAGGTAGCGGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182700.2-886s1c1
Sequence:CCGGCGGAGGCTACAACTCGGATTACTCGAGTAATCCGAGTTGTAGCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182700.2-205s1c1
Sequence:CCGGCAGCTCTTCTTCCTTCGGCAACTCGAGTTGCCGAAGGAAGAAGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182700
SP8 MISSION shRNA Lentiviral Transduction Particles
Sp8 transcription factor
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182700.4-1983s21c1
Sequence:CCGGTGGAGGTAGAGCTGGACTAATCTCGAGATTAGTCCAGCTCTACCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182700.4-694s21c1
Sequence:CCGGCCCGTACGAGTCGTGGTTTAACTCGAGTTAAACCACGACTCGTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182700.2-613s1c1
Sequence:CCGGCCAGCCGGTGTTCATCTCCAACTCGAGTTGGAGATGAACACCGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182700.2-1429s1c1
Sequence:CCGGCCACCTCAGCAAGCACGTGAACTCGAGTTCACGTGCTTGCTGAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182700.2-145s1c1
Sequence:CCGGGCTTGCCGCTACCTGTAATAACTCGAGTTATTACAGGTAGCGGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182700.2-886s1c1
Sequence:CCGGCGGAGGCTACAACTCGGATTACTCGAGTAATCCGAGTTGTAGCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182700.2-205s1c1
Sequence:CCGGCAGCTCTTCTTCCTTCGGCAACTCGAGTTGCCGAAGGAAGAAGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177082
SP8 MISSION shRNA Bacterial Glycerol Stock
Sp8 transcription factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177082.3-3724s1c1
Sequence:CCGGCCAGGATTTATTGACCTCTTACTCGAGTAAGAGGTCAATAAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177082.3-878s1c1
Sequence:CCGGGAGGCTACAACTCGGATTATTCTCGAGAATAATCCGAGTTGTAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177082.3-678s1c1
Sequence:CCGGGCACCCGTATGAGTCCTGGTTCTCGAGAACCAGGACTCATACGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177082.3-1386s1c1
Sequence:CCGGCCCGGTGTGCAACAAACGCTTCTCGAGAAGCGTTTGTTGCACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177082.3-681s1c1
Sequence:CCGGCCCGTATGAGTCCTGGTTCAACTCGAGTTGAACCAGGACTCATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177082
SP8 MISSION shRNA shRNA Plasmid DNA
Sp8 transcription factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177082.3-3724s1c1
Sequence:CCGGCCAGGATTTATTGACCTCTTACTCGAGTAAGAGGTCAATAAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177082.3-878s1c1
Sequence:CCGGGAGGCTACAACTCGGATTATTCTCGAGAATAATCCGAGTTGTAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177082.3-678s1c1
Sequence:CCGGGCACCCGTATGAGTCCTGGTTCTCGAGAACCAGGACTCATACGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177082.3-1386s1c1
Sequence:CCGGCCCGGTGTGCAACAAACGCTTCTCGAGAAGCGTTTGTTGCACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177082.3-681s1c1
Sequence:CCGGCCCGTATGAGTCCTGGTTCAACTCGAGTTGAACCAGGACTCATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177082
SP8 MISSION shRNA Lentiviral Transduction Particles
Sp8 transcription factor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177082.3-3724s1c1
Sequence:CCGGCCAGGATTTATTGACCTCTTACTCGAGTAAGAGGTCAATAAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177082.3-878s1c1
Sequence:CCGGGAGGCTACAACTCGGATTATTCTCGAGAATAATCCGAGTTGTAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177082.3-678s1c1
Sequence:CCGGGCACCCGTATGAGTCCTGGTTCTCGAGAACCAGGACTCATACGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177082.3-1386s1c1
Sequence:CCGGCCCGGTGTGCAACAAACGCTTCTCGAGAAGCGTTTGTTGCACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177082.3-681s1c1
Sequence:CCGGCCCGTATGAGTCCTGGTTCAACTCGAGTTGAACCAGGACTCATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks