EMAIL THIS PAGE TO A FRIEND

SP9

Sp9 transcription factor

Synonyms: ZNF990
UniProtKB ID: P0CG40
Gene ID:
Mouse(381373) trans-acting transcription factor 9
Rat(366078) trans-acting transcription factor 9
Zebrafish(405896) sp9 transcription factor
dog(488406) Sp9 transcription factor homolog (mouse)
naked mole-rat(101712093) Sp9 transcription factor
domestic guinea pig(100727725) Sp9 transcription factor
cow(517257) Sp9 transcription factor homolog (mouse)
sheep(101106151) Sp9 transcription factor homolog (mouse)
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA062616 Anti-SP9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005343 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005343 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005343 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU225011 MISSION® esiRNA esiRNA targeting human SP9 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001721877 Rosetta Predictions human pricing
XM_001721888 Rosetta Predictions human pricing
XM_001725769 Rosetta Predictions human pricing
XM_001061854 Rosetta Predictions rat pricing
XM_345371 Rosetta Predictions rat pricing
NM_001005343 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00445622 predicted 556
2 SASI_Hs02_00445623 predicted 450
3 SASI_Hs02_00445624 predicted 385
4 SASI_Hs02_00445625 predicted 452
5 SASI_Hs02_00445626 predicted 559
6 SASI_Hs02_00445627 predicted 381
7 SASI_Hs02_00445628 predicted 373
8 SASI_Hs02_00445629 predicted 379
9 SASI_Hs02_00445630 predicted 384
10 SASI_Hs02_00445631 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00445719 predicted 459
2 SASI_Hs02_00445720 predicted 377
3 SASI_Hs02_00445721 predicted 454
4 SASI_Hs02_00445722 predicted 381
5 SASI_Hs02_00445723 predicted 390
6 SASI_Hs02_00445724 predicted 370
7 SASI_Hs02_00445725 predicted 373
8 SASI_Hs02_00445726 predicted 383
9 SASI_Hs02_00445727 predicted 454
10 SASI_Hs02_00445728 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00469878 predicted 556
2 SASI_Hs02_00469879 predicted 451
3 SASI_Hs02_00469880 predicted 384
4 SASI_Hs02_00469881 predicted 452
5 SASI_Hs02_00469882 predicted 555
6 SASI_Hs02_00469883 predicted 380
7 SASI_Hs02_00469884 predicted 370
8 SASI_Hs02_00469885 predicted 376
9 SASI_Hs02_00469886 predicted 380
10 SASI_Hs02_00469887 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061854 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301514 predicted 252
2 SASI_Rn02_00301515 predicted 209
3 SASI_Rn02_00301516 predicted 1774
4 SASI_Rn02_00301517 predicted 1787
5 SASI_Rn02_00301518 predicted 2078
6 SASI_Rn02_00301519 predicted 1465
7 SASI_Rn02_00301520 predicted 1955
8 SASI_Rn02_00301521 predicted 1968
9 SASI_Rn02_00301522 predicted 1985
10 SASI_Rn02_00301523 predicted 1811
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345371 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398297 predicted 1030
2 SASI_Rn02_00398298 predicted 253
3 SASI_Rn02_00398299 predicted 967
4 SASI_Rn02_00398300 predicted 206
5 SASI_Rn02_00398301 predicted 208
6 SASI_Rn02_00398302 predicted 1028
7 SASI_Rn02_00398303 predicted 974
8 SASI_Rn02_00398304 predicted 976
9 SASI_Rn02_00398305 predicted 251
10 SASI_Rn02_00398306 predicted 1259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005343 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103114 predicted 210
2 SASI_Mm01_00103115 predicted 982
3 SASI_Mm01_00103116 predicted 222
4 SASI_Mm01_00103117 predicted 984
5 SASI_Mm01_00103118 predicted 980
6 SASI_Mm01_00103119 predicted 1033
7 SASI_Mm01_00103120 predicted 941
8 SASI_Mm01_00103121 predicted 977
9 SASI_Mm01_00103122 predicted 934
10 SASI_Mm01_00103123 predicted 825
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005343
SP9 MISSION shRNA Bacterial Glycerol Stock
Sp9 transcription factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005343.1-1864s1c1
Sequence:CCGGCCGACATAAGTGCAGGTTCAACTCGAGTTGAACCTGCACTTATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005343.1-1337s1c1
Sequence:CCGGCCCTGTGTGCAACAAGCGTTTCTCGAGAAACGCTTGTTGCACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005343.1-221s1c1
Sequence:CCGGGACCTGCAACAAGATCGGCAACTCGAGTTGCCGATCTTGTTGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005343.1-1376s1c1
Sequence:CCGGGAGCAAACACATTAAGACGCACTCGAGTGCGTCTTAATGTGTTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005343.1-614s1c1
Sequence:CCGGCCCGTACGAGTCGTGGTACAACTCGAGTTGTACCACGACTCGTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005343
SP9 MISSION shRNA shRNA Plasmid DNA
Sp9 transcription factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005343.1-1864s1c1
Sequence:CCGGCCGACATAAGTGCAGGTTCAACTCGAGTTGAACCTGCACTTATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005343.1-1337s1c1
Sequence:CCGGCCCTGTGTGCAACAAGCGTTTCTCGAGAAACGCTTGTTGCACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005343.1-221s1c1
Sequence:CCGGGACCTGCAACAAGATCGGCAACTCGAGTTGCCGATCTTGTTGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005343.1-1376s1c1
Sequence:CCGGGAGCAAACACATTAAGACGCACTCGAGTGCGTCTTAATGTGTTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005343.1-614s1c1
Sequence:CCGGCCCGTACGAGTCGTGGTACAACTCGAGTTGTACCACGACTCGTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005343
SP9 MISSION shRNA Lentiviral Transduction Particles
Sp9 transcription factor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005343.1-1864s1c1
Sequence:CCGGCCGACATAAGTGCAGGTTCAACTCGAGTTGAACCTGCACTTATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005343.1-1337s1c1
Sequence:CCGGCCCTGTGTGCAACAAGCGTTTCTCGAGAAACGCTTGTTGCACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005343.1-221s1c1
Sequence:CCGGGACCTGCAACAAGATCGGCAACTCGAGTTGCCGATCTTGTTGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005343.1-1376s1c1
Sequence:CCGGGAGCAAACACATTAAGACGCACTCGAGTGCGTCTTAATGTGTTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005343.1-614s1c1
Sequence:CCGGCCCGTACGAGTCGTGGTACAACTCGAGTTGTACCACGACTCGTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks