EMAIL THIS PAGE TO A FRIEND

SPA17

sperm autoantigenic protein 17

Synonyms: CT22 SP17 SP17-1
UniProtKB ID: Q15506, B2R4F2, Q9BXF7
Gene ID:
Human(53340) Summary: This gene encodes a protein present at the cell surface. The N-terminus has sequence similarity to human cAMP-dependent protein kinase A (PKA) type II alpha regulatory subunit (RIIa) while the C-terminus has an IQ calmodulin-binding motif. The central portion of the protein has carbohydrate binding motifs and likely functions in cell-cell adhesion. The protein was initially characterized by its involvement in the binding of sperm to the zona pellucida of the oocyte. Recent studies indicate that it is also involved in additional cell-cell adhesion functions such as immune cell migration and metastasis. A retrotransposed pseudogene is present on chromosome 10q22.[provided by RefSeq, Jan 2009]
Mouse(20686) sperm autoantigenic protein 17
Rat(85244) sperm autoantigenic protein 17
dog(479402) sperm autoantigenic protein 17
domestic cat(101080571) sperm autoantigenic protein 17
cow(616974) sperm autoantigenic protein 17
domestic guinea pig(100723003) sperm autoantigenic protein 17
naked mole-rat(101719052) sperm autoantigenic protein 17
Domestic Rabbit(100009312) sperm autoantigenic protein 17
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011449 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011449 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011449 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017425 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017425 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017425 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017425 Rosetta Predictions human pricing
NM_053482 Rosetta Predictions rat pricing
NM_011449 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011308 predicted 393
2 SASI_Hs01_00011309 predicted 323
3 SASI_Hs01_00011310 predicted 283
4 SASI_Hs01_00011311 predicted 318
5 SASI_Hs01_00011312 predicted 441
6 SASI_Hs01_00011313 predicted 630
7 SASI_Hs01_00011314 predicted 355
8 SASI_Hs01_00011315 predicted 578
9 SASI_Hs02_00349998 predicted 325
10 SASI_Hs02_00349999 predicted 391
11 SASI_Hs01_00011306 predicted 631
12 SASI_Hs01_00011307 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053482 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095227 predicted 208
2 SASI_Rn01_00095228 predicted 217
3 SASI_Rn01_00095229 predicted 219
4 SASI_Rn01_00095230 predicted 208
5 SASI_Rn01_00095231 predicted 215
6 SASI_Rn01_00095232 predicted 291
7 SASI_Rn01_00095233 predicted 180
8 SASI_Rn01_00095234 predicted 21
9 SASI_Rn01_00095235 predicted 72
10 SASI_Rn01_00095236 predicted 84
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011449 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035348 predicted 282
2 SASI_Mm01_00035349 predicted 346
3 SASI_Mm01_00035350 predicted 342
4 SASI_Mm01_00035351 predicted 274
5 SASI_Mm01_00035352 predicted 283
6 SASI_Mm01_00035353 predicted 279
7 SASI_Mm01_00035354 predicted 341
8 SASI_Mm01_00035355 predicted 277
9 SASI_Mm01_00035356 predicted 330
10 SASI_Mm01_00035357 predicted 286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011449
VALIDATED
SPA17 MISSION shRNA Bacterial Glycerol Stock
sperm autoantigenic protein 17
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011449.1-311s1c1
Sequence:CCGGGCATTCAAGGAACAAGAACAACTCGAGTTGTTCTTGTTCCTTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011449.1-294s1c1
Sequence:CCGGGCTTCTATAACAACCACGCATCTCGAGATGCGTGGTTGTTATAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011449.1-187s1c1
Sequence:CCGGACCGGACAATATACCAGCTTTCTCGAGAAAGCTGGTATATTGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011449.1-295s1c1
Sequence:CCGGCTTCTATAACAACCACGCATTCTCGAGAATGCGTGGTTGTTATAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011449.1-121s1c1
Sequence:CCGGCTACCGAATTCCACAAGGATTCTCGAGAATCCTTGTGGAATTCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011449.1-295s21c1
Sequence:CCGGCTTCTATAACAACCACGCATTCTCGAGAATGCGTGGTTGTTATAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011449.1-341s21c1
Sequence:CCGGTGTGAACAAGAATTAGCTAAGCTCGAGCTTAGCTAATTCTTGTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011449.1-394s21c1
Sequence:CCGGCTTCGAGGAGTCTACTGAGGACTCGAGTCCTCAGTAGACTCCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011449.1-371s21c1
Sequence:CCGGAGAGAAGAAACACCAGTCACTCTCGAGAGTGACTGGTGTTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011449.1-187s21c1
Sequence:CCGGACCGGACAATATACCAGCTTTCTCGAGAAAGCTGGTATATTGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011449
VALIDATED
SPA17 MISSION shRNA shRNA Plasmid DNA
sperm autoantigenic protein 17
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011449.1-311s1c1
Sequence:CCGGGCATTCAAGGAACAAGAACAACTCGAGTTGTTCTTGTTCCTTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011449.1-294s1c1
Sequence:CCGGGCTTCTATAACAACCACGCATCTCGAGATGCGTGGTTGTTATAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011449.1-187s1c1
Sequence:CCGGACCGGACAATATACCAGCTTTCTCGAGAAAGCTGGTATATTGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011449.1-295s1c1
Sequence:CCGGCTTCTATAACAACCACGCATTCTCGAGAATGCGTGGTTGTTATAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011449.1-121s1c1
Sequence:CCGGCTACCGAATTCCACAAGGATTCTCGAGAATCCTTGTGGAATTCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011449.1-295s21c1
Sequence:CCGGCTTCTATAACAACCACGCATTCTCGAGAATGCGTGGTTGTTATAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011449.1-341s21c1
Sequence:CCGGTGTGAACAAGAATTAGCTAAGCTCGAGCTTAGCTAATTCTTGTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011449.1-394s21c1
Sequence:CCGGCTTCGAGGAGTCTACTGAGGACTCGAGTCCTCAGTAGACTCCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011449.1-371s21c1
Sequence:CCGGAGAGAAGAAACACCAGTCACTCTCGAGAGTGACTGGTGTTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011449.1-187s21c1
Sequence:CCGGACCGGACAATATACCAGCTTTCTCGAGAAAGCTGGTATATTGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011449
VALIDATED
SPA17 MISSION shRNA Lentiviral Transduction Particles
sperm autoantigenic protein 17
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011449.1-311s1c1
Sequence:CCGGGCATTCAAGGAACAAGAACAACTCGAGTTGTTCTTGTTCCTTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011449.1-294s1c1
Sequence:CCGGGCTTCTATAACAACCACGCATCTCGAGATGCGTGGTTGTTATAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011449.1-187s1c1
Sequence:CCGGACCGGACAATATACCAGCTTTCTCGAGAAAGCTGGTATATTGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011449.1-295s1c1
Sequence:CCGGCTTCTATAACAACCACGCATTCTCGAGAATGCGTGGTTGTTATAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011449.1-121s1c1
Sequence:CCGGCTACCGAATTCCACAAGGATTCTCGAGAATCCTTGTGGAATTCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011449.1-295s21c1
Sequence:CCGGCTTCTATAACAACCACGCATTCTCGAGAATGCGTGGTTGTTATAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011449.1-341s21c1
Sequence:CCGGTGTGAACAAGAATTAGCTAAGCTCGAGCTTAGCTAATTCTTGTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011449.1-394s21c1
Sequence:CCGGCTTCGAGGAGTCTACTGAGGACTCGAGTCCTCAGTAGACTCCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011449.1-371s21c1
Sequence:CCGGAGAGAAGAAACACCAGTCACTCTCGAGAGTGACTGGTGTTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011449.1-187s21c1
Sequence:CCGGACCGGACAATATACCAGCTTTCTCGAGAAAGCTGGTATATTGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017425
VALIDATED
SPA17 MISSION shRNA Bacterial Glycerol Stock
sperm autoantigenic protein 17
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017425.2-349s1c1
Sequence:CCGGCATGCATTCGAGGAGCAAGAACTCGAGTTCTTGCTCCTCGAATGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017425.2-172s1c1
Sequence:CCGGCCACAAGGATTTGGGAATCTTCTCGAGAAGATTCCCAAATCCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017425.2-434s1c1
Sequence:CCGGCAGTCACCATCTTAGACTCTTCTCGAGAAGAGTCTAAGATGGTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146362    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017425.2-751s1c1
Sequence:CCGGCATTGAAACATGCCACTTGAACTCGAGTTCAAGTGGCATGTTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017425.3-173s21c1
Sequence:CCGGCCACAAGGATTTGGGAATCTTCTCGAGAAGATTCCCAAATCCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_017425.3-435s21c1
Sequence:CCGGCAGTCACCATCTTAGACTCTTCTCGAGAAGAGTCTAAGATGGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_017425.3-635s21c1
Sequence:CCGGATCCATCAACCTTCTTATTAACTCGAGTTAATAAGAAGGTTGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017425.3-350s21c1
Sequence:CCGGCATGCATTCGAGGAGCAAGAACTCGAGTTCTTGCTCCTCGAATGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017425.3-219s21c1
Sequence:CCGGTGAGAGAGCAACCGGACAATACTCGAGTATTGTCCGGTTGCTCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017425
VALIDATED
SPA17 MISSION shRNA shRNA Plasmid DNA
sperm autoantigenic protein 17
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017425.2-349s1c1
Sequence:CCGGCATGCATTCGAGGAGCAAGAACTCGAGTTCTTGCTCCTCGAATGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017425.2-172s1c1
Sequence:CCGGCCACAAGGATTTGGGAATCTTCTCGAGAAGATTCCCAAATCCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017425.2-434s1c1
Sequence:CCGGCAGTCACCATCTTAGACTCTTCTCGAGAAGAGTCTAAGATGGTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146362    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017425.2-751s1c1
Sequence:CCGGCATTGAAACATGCCACTTGAACTCGAGTTCAAGTGGCATGTTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017425.3-173s21c1
Sequence:CCGGCCACAAGGATTTGGGAATCTTCTCGAGAAGATTCCCAAATCCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_017425.3-435s21c1
Sequence:CCGGCAGTCACCATCTTAGACTCTTCTCGAGAAGAGTCTAAGATGGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_017425.3-635s21c1
Sequence:CCGGATCCATCAACCTTCTTATTAACTCGAGTTAATAAGAAGGTTGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017425.3-350s21c1
Sequence:CCGGCATGCATTCGAGGAGCAAGAACTCGAGTTCTTGCTCCTCGAATGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017425.3-219s21c1
Sequence:CCGGTGAGAGAGCAACCGGACAATACTCGAGTATTGTCCGGTTGCTCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017425
VALIDATED
SPA17 MISSION shRNA Lentiviral Transduction Particles
sperm autoantigenic protein 17
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017425.2-349s1c1
Sequence:CCGGCATGCATTCGAGGAGCAAGAACTCGAGTTCTTGCTCCTCGAATGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017425.2-172s1c1
Sequence:CCGGCCACAAGGATTTGGGAATCTTCTCGAGAAGATTCCCAAATCCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017425.2-434s1c1
Sequence:CCGGCAGTCACCATCTTAGACTCTTCTCGAGAAGAGTCTAAGATGGTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146362    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017425.2-751s1c1
Sequence:CCGGCATTGAAACATGCCACTTGAACTCGAGTTCAAGTGGCATGTTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017425.3-173s21c1
Sequence:CCGGCCACAAGGATTTGGGAATCTTCTCGAGAAGATTCCCAAATCCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_017425.3-435s21c1
Sequence:CCGGCAGTCACCATCTTAGACTCTTCTCGAGAAGAGTCTAAGATGGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_017425.3-635s21c1
Sequence:CCGGATCCATCAACCTTCTTATTAACTCGAGTTAATAAGAAGGTTGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017425.3-350s21c1
Sequence:CCGGCATGCATTCGAGGAGCAAGAACTCGAGTTCTTGCTCCTCGAATGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017425.3-219s21c1
Sequence:CCGGTGAGAGAGCAACCGGACAATACTCGAGTATTGTCCGGTTGCTCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks